Entry Detail


General Information

Database ID:TRD03347
Confidence:Very High
Contents:>> tsRNA Information
>> tsRNA Association Statistics
>> Disease Information
>> Disease Association Statistics
>> Evidence Support
>> Reference



tsRNA Information

tsRNA Name:AS-tDR-007333_n1
tsRNA Type:tRF-5
Amino acid and Anticodon:GlyGCC
Sequence:AAGAATTCTACCACTGAACCACCAATGC
Related Target:N/A
Predicted Target:PBX2//ADAM10//ATP6AP2//MOGS//CPOX//TRIM56//KRT4//KIF3B//POLG2//BNIP1
External Links:
MINTbase ID:N/A
tRFdb ID:N/A



tsRNA Association Statistics

Total Associated Disease Number:4
More Information
Network:
(Display the first 15 nodes)



Disease Information

 MeSHDisease Ontology
Disease ID:D008175DOID:1324
Disease Name:Lung Neoplasmslung cancer
Category:MeSHDisease Ontology
Type:Neoplasms//Respiratory Tract Diseasesdisease of anatomical entity//disease of cellular proliferation
Define:Tumors or cancer of the LUNG.A respiratory system cancer that is located_in the lung.
Alias:Cancer of Lung//Cancer of the Lung//Lung Cancer//Neoplasms, Lung//Neoplasms, Pulmonary//Pulmonary Cancer//Pulmonary Neoplasmslung neoplasm



Disease Association Statistics

Total Associated tsRNA Number:102
More Information
Network:
(Display the first 15 nodes)



Evidence Support

Strong Evidence:RT-PCR//FISH
Weak Evidence:N/A



Reference

[1] PubMed ID:35526007
Disease Name:Lung Neoplasms
Tissue:Plasma; Bronchial Epithelial Cell; Lung Tissue
Dysfunction Pattern:Up-Regulation
Validated Method:RT-PCR//FISH
Description:AS-tDR-007333 was an uncharacterized tRF and significantly up-regulated in NSCLC tissues, plasma, and cells.
Comparision:Cancer VS Normal
Mechanism:Overexpression of AS-tDR-007333 enhanced proliferation and migration of NSCLC cells, whereas knockdown of AS-tDR-007333 resulted in opposite effects. Mechanistically, AS-tDR-007333 promoted the malignancy of NSCLC cells by activating MED29 through two distinct mechanisms. First AS-tDR-007333 bound to and interacted with HSPB1, which activated MED29 expression by enhancing H3K4me1 and H3K27ac in MED29 promoter. Second, AS-tDR-007333 stimulated the expression of transcription factor ELK4, which bound to MED29 promoter and increased its transcription.