Entry Detail



General Information

Database ID:TRD03345
Confidence:Median
Contents:>> tsRNA Information
>> tsRNA Association Statistics
>> Disease Information
>> Disease Association Statistics
>> Evidence Support
>> Reference



tsRNA Information

tsRNA Name:AS-tDR-007303
tsRNA Type:tRF-5
Amino acid and Anticodon:GlyGCC
Sequence:GCATGGGTGGTTCAGTGGTAGAATTCTT
Related Target:N/A
Predicted Target:FCGR2A//SORCS1//HSD17B4//MRPS5//SP3//TNS2//DDI1//CDCP2//AL357673.1//UBN1
External Links:
MINTbase ID:N/A
tRFdb ID:N/A



tsRNA Association Statistics

Total Associated Disease Number:4
More Information
Network:
(Display the first 15 nodes)



Disease Information

 MeSHDisease Ontology
Disease ID:D010190DOID:1793
Disease Name:Pancreatic Neoplasmspancreatic cancer
Category:MeSHDisease Ontology
Type:Neoplasms//Digestive System Diseases//Endocrine System Diseasesdisease of anatomical entity//disease of cellular proliferation
Define:Tumors or cancer of the PANCREAS. Depending on the types of ISLET CELLS present in the tumors, various hormones can be secreted: GLUCAGON from PANCREATIC ALPHA CELLS; INSULIN from PANCREATIC BETA CELLS; and SOMATOSTATIN from the SOMATOSTATIN-SECRETING CELLS. Most are malignant except the insulin-producing tumors (INSULINOMA).An endocrine gland cancer located_in the pancreas.
Alias:Cancer of Pancreas//Cancer of the Pancreas//Neoplasms, Pancreatic//Pancreas Cancer//Pancreas Neoplasms//Pancreatic CancerCa body of pancreas//Ca head of pancreas//Ca tail of pancreas//malignant neoplasm of body of pancreas//malignant neoplasm of head of pancreas//malignant neoplasm of tail of pancreas pancreas neoplasm [EXACT] pancreatic neoplasm [EXACT] pancreatic tumor [EXACT]



Disease Association Statistics

Total Associated tsRNA Number:112
More Information
Network:
(Display the first 15 nodes)



Evidence Support

Strong Evidence:N/A
Weak Evidence:High-throughput sequencing



Reference

[1] PubMed ID:31452788
Disease Name:Pancreatic Neoplasms
Tissue:N/A
Dysfunction Pattern:Up-Regulation
Validated Method:High-throughput sequencing
Description:A total of 48 DE-tRFs and tiRNAs were screened from the pancreatic cancer samples and adjacent normal tissue samples, including 46 upregulated tRFs and tiRNAs and 2 downregulated tRFs and tiRNAs (Table III).
Comparision:Cancer VS Adjacent Normal Tissue
Mechanism:N/A