Entry Detail



General Information

Database ID:TRD03334
Confidence:Median
Contents:>> tsRNA Information
>> tsRNA Association Statistics
>> Disease Information
>> Disease Association Statistics
>> Evidence Support
>> Reference



tsRNA Information

tsRNA Name:5'GlyGCC
tsRNA Type:tRF-5
Amino acid and Anticodon:GlyGCC
Sequence:AATCCTAACCACTAGACCACCAGGGA
Related Target:N/A
Predicted Target:HMCN2//REEP4//KCNJ10//FIS1//SERPINB6//SPSB2//ZHX2//CD84//CADM1//B3GALT5
External Links:
MINTbase ID:N/A
tRFdb ID:N/A



tsRNA Association Statistics

Total Associated Disease Number:11
More Information
Network:
(Display the first 15 nodes)



Disease Information

 MeSHDisease Ontology
Disease ID:D004827DOID:1826
Disease Name:Epilepsyepilepsy
Category:MeSHDisease Ontology
Type:Nervous System Diseasesdisease of anatomical entity
Define:A disorder characterized by recurrent episodes of paroxysmal brain dysfunction due to a sudden, disorderly, and excessive neuronal discharge. Epilepsy classification systems are generally based upon: (1) clinical features of the seizure episodes (e.g., motor seizure), (2) etiology (e.g., post-traumatic), (3) anatomic site of seizure origin (e.g., frontal lobe seizure), (4) tendency to spread to other structures in the brain, and (5) temporal patterns (e.g., nocturnal epilepsy). (From Adams et al., Principles of Neurology, 6th ed, p313)A brain disease that is characterized by the occurrance of at least two unprovoked seizures resulting from a persistent epileptogenic abnormality of the brain that is able to spontaneously generate paroxysmal activity and typically manifested by sudden brief episodes of altered or diminished consciousness, involuntary movements, or convulsions.
Alias:Aura//Awakening Epilepsy//Epilepsy, Cryptogenic//Seizure Disorderepilepsy syndrome//epileptic syndrome



Disease Association Statistics

Total Associated tsRNA Number:47
More Information
Network:
(Display the first 15 nodes)



Evidence Support

Strong Evidence:RT-PCR
Weak Evidence:N/A



Reference

[1] PubMed ID:32371908
Disease Name:Epilepsy
Tissue:Blood
Dysfunction Pattern:Little Sensitivity
Validated Method:RT-PCR
Description:The 5'GlyGCC assay appears to show an all-or-nothing signal with little sensitivity to subtle changes in tRF levels, indicating this assay may not be suitable for a seizure prediction device. However, 5'AlaTGC and 5'GluCTC levels show similar fold-change between pre and post seizure samples indicating these would be best for further development.
Comparision:Pre-seizure VS Post-seizure
Mechanism:In the majority of samples, the tRF levels were higher in pre-seizure samples.