Entry Detail



General Information

Database ID:TRD03284
Confidence:Median
Contents:>> tsRNA Information
>> tsRNA Association Statistics
>> Disease Information
>> Disease Association Statistics
>> Evidence Support
>> Reference



tsRNA Information

tsRNA Name:tRF-Gly-CCC-005
tsRNA Type:tRF-5
Amino acid and Anticodon:GlyCCC
Sequence:GCATTGGTGGTTCAATGGTAGAATTCTCGCCT
Related Target:N/A
Predicted Target:FCGR2A//LPAR1//ANAPC2//COL6A5//ACAN//ERAS//DPF1//AGBL3//SLC26A6//DNAH12
External Links:
MINTbase ID:tRF-32-PNR8YO9LON4V3
tRFdb ID:N/A

[1] gtRNAdb_ID:tRNA-Gly-CCC-3-1
Anticodon:GlyCCC
tRNA_number:trna13
Chromosome:17
Strand:+
Coordinate:Start Site(bp): 19764175        End Site(bp): 19764206



tsRNA Association Statistics

Total Associated Disease Number:10
More Information
Network:
(Display the first 15 nodes)



Disease Information

 MeSHDisease Ontology
Disease ID:D008180DOID:9074
Disease Name:Lupus Erythematosus, Systemicsystemic lupus erythematosus
Category:MeSHDisease Ontology
Type:Skin and Connective Tissue Diseases//Immune System Diseasesdisease of anatomical entity
Define:A chronic, relapsing, inflammatory, and often febrile multisystemic disorder of connective tissue, characterized principally by involvement of the skin, joints, kidneys, and serosal membranes. It is of unknown etiology, but is thought to represent a failure of the regulatory mechanisms of the autoimmune system. The disease is marked by a wide range of system dysfunctions, an elevated erythrocyte sedimentation rate, and the formation of LE cells in the blood or bone marrow.A lupus erythematosus that is an inflammation of connective tissue marked by skin rashes, joint pain and swelling, inflammation of the kidneys and inflammation of the tissue surrounding the heart.
Alias:Libman-Sacks Disease//Lupus Erythematosus Disseminatus//Systemic Lupus Erythematosusdisseminated lupus erythematosus//Lupus Erythematosus, systemic//SLE - Lupus Erythematosus, systemic



Disease Association Statistics

Total Associated tsRNA Number:111
More Information
Network:
(Display the first 15 nodes)



Evidence Support

Strong Evidence:N/A
Weak Evidence:High-throughput sequencing//Microarray



Reference

[1] PubMed ID:32423797
Disease Name:Lupus Erythematosus, Systemic
Tissue:Peripheral Venous Blood
Dysfunction Pattern:Down-Regulation
Validated Method:High-throughput sequencing//Microarray
Description:GO analysis revealed that the altered target genes of the selected tRNAs and tsRNAs were most enriched similarly in immune response and the immune system process. Moreover, KEGG pathway analysis demonstrated that altered target genes of tRNAs were most enriched in systemic lupus erythematosus, while the altered target genes of tsRNAs were most enriched in the T cell receptor signalling pathway, Th1 and Th2 cell differentiation and primary immunodeficiency. These pathways may be related to the initiation of SLE.
Comparision:Disease VS Control
Mechanism:N/A