Entry Detail



General Information

Database ID:TRD03021
Confidence:Median
Contents:>> tsRNA Information
>> tsRNA Association Statistics
>> Disease Information
>> Disease Association Statistics
>> Evidence Support
>> Reference



tsRNA Information

tsRNA Name:tRF-Arg-TCT-008
tsRNA Type:tRF-5
Amino acid and Anticodon:ArgTCT
Sequence:GGCTCCGTGGCGCAATGGATAGCGCATTGG
Related Target:N/A
Predicted Target:HES7//TULP4//OR10J1//SLC25A29//DENND2A//DBNDD1//HIP1R//ADAMTS5//TRPT1//SLC25A18
External Links:
MINTbase ID:tRF-21-B54ZUPX1B
tRFdb ID:N/A

[1] gtRNAdb_ID:tRNA-Arg-TCT-1-1
Anticodon:ArgTCT
tRNA_number:trna9
Chromosome:1
Strand:+
Coordinate:Start Site(bp): 94313129        End Site(bp): 94313158



tsRNA Association Statistics

Total Associated Disease Number:3
More Information
Network:
(Display the first 15 nodes)



Disease Information

 MeSHDisease Ontology
Disease ID:D010051DOID:2394
Disease Name:Ovarian Neoplasmsovarian cancer
Category:MeSHDisease Ontology
Type:Neoplasms//Urogenital Diseases//Endocrine System Diseasesdisease of anatomical entity//disease of cellular proliferation
Define:Tumors or cancer of the OVARY. These neoplasms can be benign or malignant. They are classified according to the tissue of origin, such as the surface EPITHELIUM, the stromal endocrine cells, and the totipotent GERM CELLS. A female reproductive organ cancer that is located_in the ovary.
Alias:Cancer of Ovary//Cancer of the Ovary//Neoplasms, Ovarian//Ovarian Cancer//Ovary Cancer//Ovary Neoplasmsmalignant Ovarian tumor//malignant tumour of ovary//ovarian neoplasm//ovary neoplasm//primary ovarian cancer//tumor of the Ovary



Disease Association Statistics

Total Associated tsRNA Number:74
More Information
Network:
(Display the first 15 nodes)



Evidence Support

Strong Evidence:N/A
Weak Evidence:High-throughput sequencing



Reference

[1] PubMed ID:33860037
Disease Name:Ovarian Neoplasms
Tissue:Ovarian
Dysfunction Pattern:Down-Regulation
Validated Method:High-throughput sequencing
Description:There are a total of 20 significantly upregulated and 15 significantly downregulated tRFs and tiRNAs between the cancer group and the paracarcinoma group.
Comparision:Cancer VS Normal
Mechanism:The upregulated tRFs and tiRNAs are mucin-type O-glycan biosynthesis, glycosphingolipid biosynthesis, the glucagon signaling pathway, the AMPK signaling pathway, maturity-onset diabetes of the young, glycosphingolipid biosynthesis, the insulin signaling pathway, insulin resistance, leukocyte transendothelial migration, starch, and sucrose metabolism.