Entry Detail


General Information

Database ID:TRD03018
Confidence:Low
Contents:>> tsRNA Information
>> tsRNA Association Statistics
>> Disease Information
>> Disease Association Statistics
>> Evidence Support
>> Reference



tsRNA Information

tsRNA Name:tRF-20-S998LO9D
tsRNA Type:tRF-5
Amino acid and Anticodon:ArgTCT
Sequence:GTCTCTGTGGCGCAATGGAC
Related Target:N/A
Predicted Target:GABRB3//ACVR2B//ALDH7A1//HES7//FBH1//PXYLP1//EFCAB5//SEPTIN1//VSIG10L2//TBC1D5
External Links:
MINTbase ID:tRF-20-S998LO9D
tRFdb ID:tRNA-Arg-TCT-4-1

[1] gtRNAdb_ID:tRNA-Arg-TCT-4-1
Anticodon:ArgTCT
tRNA_number:trna86
Chromosome:1
Strand:-
Coordinate:Start Site(bp): 159111455        End Site(bp): 159111474



tsRNA Association Statistics

Total Associated Disease Number:41
More Information
Network:
(Display the first 15 nodes)



Disease Information

 MeSHDisease Ontology
Disease ID:D000077195DOID:5520
Disease Name:Squamous Cell Carcinoma of Head and Neckhead and neck squamous cell carcinom
Category:MeSHDisease Ontology
Type:Neoplasmsdisease of cellular proliferation
Define:The most common type of head and neck carcinoma that originates from cells on the surface of the NASAL CAVITY; MOUTH; PARANASAL SINUSES, SALIVARY GLANDS, and LARYNX. Mutations in TNFRSF10B, PTEN, and ING1 genes are associated with this cancer.A head and neck carcinoma that has_material_basis_in squamous cells that line the moist, mucosal surfaces inside the head and neck.
Alias:Carcinoma, Squamous Cell of Head and Neck//HNSCC//Head And Neck Squamous Cell Carcinomas//Head and Neck Squamous Cell Carcinoma//Hypopharyngeal Squamous Cell Carcinoma//Laryngeal Squamous Cell Carcinoma//Oral Cavity Squamous Cell Carcinoma//Oral Squamous Cell Carcinoma//Oral Squamous Cell Carcinomas//Oral Tongue Squamous Cell Carcinoma//Oropharyngeal Squamous Cell Carcinoma//Squamous Cell Carcinoma of Larynx//Squamous Cell Carcinoma of the Head and Neck//Squamous Cell Carcinoma of the Larynx//Squamous Cell Carcinoma of the Mouth//Squamous Cell Carcinoma of the Nasal Cavity//Squamous Cell Carcinoma, Head And Neckcarcinoma of the head and neck//squamous cell carcinoma of the head and neck//squamous cell carcinomas of head and neck



Disease Association Statistics

Total Associated tsRNA Number:38
More Information
Network:
(Display the first 15 nodes)



Evidence Support

Strong Evidence:N/A
Weak Evidence:Data Mining



Reference

[1] PubMed ID:35571614
Disease Name:Squamous Cell Carcinoma of Head and Neck
Tissue:HNSC
Dysfunction Pattern:Up-Regulation
Validated Method:Data Mining
Description:We found that tRF-20-S998LO9D was highly expressed in a variety of cancers like breast invasive carcinoma, head and neck squamous cell carcinoma, kidney renal clear cell carcinoma, lung squamous cell carcinoma, pheochromocytoma and paraganglioma, and uterine corpus endometrial carcinoma.
Comparision:Disease VS Normal
Mechanism:KEGG pathway prediction showed that tRF-20-S998LO10D might be involved in cancer hallmark pathways. For instance, Hippo signaling has been demonstrated to play a crucial role in cell proliferation and contribute to cancer progression.