Entry Detail



General Information

Database ID:TRD03017
Confidence:Low
Contents:>> tsRNA Information
>> tsRNA Association Statistics
>> Disease Information
>> Disease Association Statistics
>> Evidence Support
>> Reference



tsRNA Information

tsRNA Name:tRF-20-S998LO9D
tsRNA Type:tRF-5
Amino acid and Anticodon:ArgTCT
Sequence:GTCTCTGTGGCGCAATGGAC
Related Target:N/A
Predicted Target:GABRB3//ACVR2B//ALDH7A1//HES7//FBH1//PXYLP1//EFCAB5//SEPTIN1//VSIG10L2//TBC1D5
External Links:
MINTbase ID:tRF-20-S998LO9D
tRFdb ID:tRNA-Arg-TCT-4-1

[1] gtRNAdb_ID:tRNA-Arg-TCT-4-1
Anticodon:ArgTCT
tRNA_number:trna86
Chromosome:1
Strand:-
Coordinate:Start Site(bp): 159111455        End Site(bp): 159111474



tsRNA Association Statistics

Total Associated Disease Number:41
More Information
Network:
(Display the first 15 nodes)



Disease Information

 MeSHDisease Ontology
Disease ID:D010673DOID:0050771
Disease Name:Pheochromocytomapheochromocytoma
Category:MeSHDisease Ontology
Type:Neoplasmsdisease of cellular proliferation
Define:A usually benign, well-encapsulated, lobular, vascular tumor of chromaffin tissue of the ADRENAL MEDULLA or sympathetic paraganglia. The cardinal symptom, reflecting the increased secretion of EPINEPHRINE and NOREPINEPHRINE, is HYPERTENSION, which may be persistent or intermittent. During severe attacks, there may be HEADACHE; SWEATING, palpitation, apprehension, TREMOR; PALLOR or FLUSHING of the face, NAUSEA and VOMITING, pain in the CHEST and ABDOMEN, and paresthesias of the extremities. The incidence of malignancy is as low as 5% but the pathologic distinction between benign and malignant pheochromocytomas is not clear.An endocrine organ benign neoplasm that arises within the adrenal medulla, releasing epinephrines and norepinephrines hormones that cause either episodic or persistent high blood pressure.
Alias:Pheochromocytoma, Extra-Adrenalphaeochromocytoma



Disease Association Statistics

Total Associated tsRNA Number:15
More Information
Network:
(Display the first 15 nodes)



Evidence Support

Strong Evidence:N/A
Weak Evidence:Data Mining



Reference

[1] PubMed ID:35571614
Disease Name:Pheochromocytoma
Tissue:PCPG
Dysfunction Pattern:Up-Regulation
Validated Method:Data Mining
Description:We found that tRF-20-S998LO9D was highly expressed in a variety of cancers like breast invasive carcinoma, head and neck squamous cell carcinoma, kidney renal clear cell carcinoma, lung squamous cell carcinoma, pheochromocytoma and paraganglioma, and uterine corpus endometrial carcinoma.
Comparision:Disease VS Normal
Mechanism:KEGG pathway prediction showed that tRF-20-S998LO11D might be involved in cancer hallmark pathways. For instance, Hippo signaling has been demonstrated to play a crucial role in cell proliferation and contribute to cancer progression.