Entry Detail



General Information

Database ID:TRD03015
Confidence:Low
Contents:>> tsRNA Information
>> tsRNA Association Statistics
>> Disease Information
>> Disease Association Statistics
>> Evidence Support
>> Reference



tsRNA Information

tsRNA Name:tRF-20-S998LO9D
tsRNA Type:tRF-5
Amino acid and Anticodon:ArgTCT
Sequence:GTCTCTGTGGCGCAATGGAC
Related Target:N/A
Predicted Target:GABRB3//ACVR2B//ALDH7A1//HES7//FBH1//PXYLP1//EFCAB5//SEPTIN1//VSIG10L2//TBC1D5
External Links:
MINTbase ID:tRF-20-S998LO9D
tRFdb ID:tRNA-Arg-TCT-4-1

[1] gtRNAdb_ID:tRNA-Arg-TCT-4-1
Anticodon:ArgTCT
tRNA_number:trna86
Chromosome:1
Strand:-
Coordinate:Start Site(bp): 159111455        End Site(bp): 159111474



tsRNA Association Statistics

Total Associated Disease Number:41
More Information
Network:
(Display the first 15 nodes)



Disease Information

 MeSHDisease Ontology
Disease ID:D016889DOID:0050939
Disease Name:Endometrial Neoplasmsuterine corpus endometrial carcinoma
Category:MeSHDisease Ontology
Type:Neoplasms//Urogenital Diseasesdisease of cellular proliferation//disease of anatomical entity
Define:Tumors or cancer of ENDOMETRIUM, the mucous lining of the UTERUS. These neoplasms can be benign or malignant. Their classification and grading are based on the various cell types and the percent of undifferentiated cells.A uterine corpus cancer that is derives_from the inner lining of the uterus.
Alias:Cancer of Endometrium//Cancer of the Endometrium//Carcinoma of Endometrium//Endometrial Cancer//Endometrial Carcinoma//Endometrium Cancer//Neoplasms, EndometrialN/A



Disease Association Statistics

Total Associated tsRNA Number:227
More Information
Network:
(Display the first 15 nodes)



Evidence Support

Strong Evidence:N/A
Weak Evidence:Data Mining



Reference

[1] PubMed ID:35571614
Disease Name:Endometrial Neoplasms
Tissue:UCEC
Dysfunction Pattern:Up-Regulation
Validated Method:Data Mining
Description:We found that tRF-20-S998LO9D was highly expressed in a variety of cancers like breast invasive carcinoma, head and neck squamous cell carcinoma, kidney renal clear cell carcinoma, lung squamous cell carcinoma, pheochromocytoma and paraganglioma, and uterine corpus endometrial carcinoma.
Comparision:Disease VS Normal
Mechanism:KEGG pathway prediction showed that tRF-20-S998LO12D might be involved in cancer hallmark pathways. For instance, Hippo signaling has been demonstrated to play a crucial role in cell proliferation and contribute to cancer progression.