Entry Detail


General Information

Database ID:TRD03014
Confidence:Low
Contents:>> tsRNA Information
>> tsRNA Association Statistics
>> Disease Information
>> Disease Association Statistics
>> Evidence Support
>> Reference



tsRNA Information

tsRNA Name:tRF-20-S998LO9D
tsRNA Type:tRF-5
Amino acid and Anticodon:ArgTCT
Sequence:GTCTCTGTGGCGCAATGGAC
Related Target:N/A
Predicted Target:GABRB3//ACVR2B//ALDH7A1//HES7//FBH1//PXYLP1//EFCAB5//SEPTIN1//VSIG10L2//TBC1D5
External Links:
MINTbase ID:tRF-20-S998LO9D
tRFdb ID:tRNA-Arg-TCT-4-1

[1] gtRNAdb_ID:tRNA-Arg-TCT-4-1
Anticodon:ArgTCT
tRNA_number:trna86
Chromosome:1
Strand:-
Coordinate:Start Site(bp): 159111455        End Site(bp): 159111474



tsRNA Association Statistics

Total Associated Disease Number:41
More Information
Network:
(Display the first 15 nodes)



Disease Information

 MeSHDisease Ontology
Disease ID:D002292DOID:4467
Disease Name:Carcinoma, Renal Cellclear cell renal cell carcinoma
Category:MeSHDisease Ontology
Type:Neoplasms//Urogenital Diseasesdisease of anatomical entity//disease of cellular proliferation
Define:A heterogeneous group of sporadic or hereditary carcinoma derived from cells of the KIDNEYS. There are several subtypes including the clear cells, the papillary, the chromophobe, the collecting duct, the spindle cells (sarcomatoid), or mixed cell-type carcinoma.A renal cell carcinoma that has_material_basis_in cells that appear very pale or clear when examined under microscope.
Alias:Adenocarcinoma Of Kidney//Adenocarcinoma, Renal//Adenocarcinoma, Renal Cell//Carcinoma, Hypernephroid//Chromophil Renal Cell Carcinoma//Chromophobe Renal Cell Carcinoma//Clear Cell Renal Carcinoma//Clear Cell Renal Cell Carcinoma//Collecting Duct Carcinoma//Collecting Duct Carcinoma (Kidney)//Collecting Duct Carcinoma of the Kidney//Grawitz Tumor//Hypernephroma//Nephroid Carcinoma//Papillary Renal Cell Carcinoma//Renal Carcinoma//Renal Cell Cancer//Renal Cell Carcinoma//Renal Cell Carcinoma, Papillary//Renal Collecting Duct Carcinoma//Sarcomatoid Renal Cell CarcinomaClear cell carcinoma of kidney//clear cell kidney carcinoma//Clear-cell metastatic renal cell carcinoma//Clear-cell metastatic renal cell carcinoma//conventional (Clear cell) renal cell carcinoma conventional renal cell carcinoma [EXACT] renal clear cell carcinoma [EXACT]



Disease Association Statistics

Total Associated tsRNA Number:17
More Information
Network:
(Display the first 15 nodes)



Evidence Support

Strong Evidence:N/A
Weak Evidence:Data Mining



Reference

[1] PubMed ID:35571614
Disease Name:Carcinoma, Renal Cell
Tissue:KIRC
Dysfunction Pattern:Up-Regulation
Validated Method:Data Mining
Description:We found that tRF-20-S998LO9D was highly expressed in a variety of cancers like breast invasive carcinoma, head and neck squamous cell carcinoma, kidney renal clear cell carcinoma, lung squamous cell carcinoma, pheochromocytoma and paraganglioma, and uterine corpus endometrial carcinoma.
Comparision:Disease VS Normal
Mechanism:KEGG pathway prediction showed that tRF-20-S998LO11D might be involved in cancer hallmark pathways. For instance, Hippo signaling has been demonstrated to play a crucial role in cell proliferation and contribute to cancer progression.