Entry Detail


General Information

Database ID:TRD03013
Confidence:Low
Contents:>> tsRNA Information
>> tsRNA Association Statistics
>> Disease Information
>> Disease Association Statistics
>> Evidence Support
>> Reference



tsRNA Information

tsRNA Name:tRF-20-S998LO9D
tsRNA Type:tRF-5
Amino acid and Anticodon:ArgTCT
Sequence:GTCTCTGTGGCGCAATGGAC
Related Target:N/A
Predicted Target:GABRB3//ACVR2B//ALDH7A1//HES7//FBH1//PXYLP1//EFCAB5//SEPTIN1//VSIG10L2//TBC1D5
External Links:
MINTbase ID:tRF-20-S998LO9D
tRFdb ID:tRNA-Arg-TCT-4-1

[1] gtRNAdb_ID:tRNA-Arg-TCT-4-1
Anticodon:ArgTCT
tRNA_number:trna86
Chromosome:1
Strand:-
Coordinate:Start Site(bp): 159111455        End Site(bp): 159111474



tsRNA Association Statistics

Total Associated Disease Number:41
More Information
Network:
(Display the first 15 nodes)



Disease Information

 MeSHDisease Ontology
Disease ID:D001943DOID:1612
Disease Name:Breast Neoplasmsbreast cancer
Category:MeSHDisease Ontology
Type:Neoplasms//Skin and Connective Tissue Diseasesdisease of anatomical entity//disease of cellular proliferation
Define:Tumors or cancer of the human BREAST.A thoracic cancer that originates in the mammary gland.
Alias:Breast Cancer//Breast Carcinoma//Breast Tumors//Cancer of Breast//Cancer of the Breast//Human Mammary Carcinoma//Malignant Neoplasm of Breast//Malignant Tumor of Breast//Mammary Cancer//Mammary Carcinoma, Human//Mammary Neoplasm, Human//Mammary Neoplasms, Human//Neoplasms, Breast//Tumors, Breastbreast tumor//malignant neoplasm of breast//malignant tumor of the breast//mammary cancer//mammary neoplasm//mammary tumor//primary breast cancer



Disease Association Statistics

Total Associated tsRNA Number:549
More Information
Network:
(Display the first 15 nodes)



Evidence Support

Strong Evidence:N/A
Weak Evidence:Data Mining



Reference

[1] PubMed ID:35571614
Disease Name:Breast Neoplasms
Tissue:BRCA
Dysfunction Pattern:Up-Regulation
Validated Method:Data Mining
Description:We found that tRF-20-S998LO9D was highly expressed in a variety of cancers like breast invasive carcinoma, head and neck squamous cell carcinoma, kidney renal clear cell carcinoma, lung squamous cell carcinoma, pheochromocytoma and paraganglioma, and uterine corpus endometrial carcinoma.
Comparision:Disease VS Normal
Mechanism:KEGG pathway prediction showed that tRF-20-S998LO9D might be involved in cancer hallmark pathways. For instance, Hippo signaling has been demonstrated to play a crucial role in cell proliferation and contribute to cancer progression.