Entry Detail



General Information

Database ID:TRD02971
Confidence:High
Contents:>> tsRNA Information
>> tsRNA Association Statistics
>> Disease Information
>> Disease Association Statistics
>> Evidence Support
>> Reference



tsRNA Information

tsRNA Name:tRF5-AlaCGC_n1
tsRNA Type:tRF-5
Amino acid and Anticodon:AlaCGC
Sequence:GGGGATGTAGCTCAGTGGTAGAGCGCGCTTC
Related Target:P65
Predicted Target:ST3GAL3//SUFU//SNX14//TPM1//NSD2//CYP46A1//MAPK12//PRDM15//FGF17//FOXL2
External Links:
MINTbase ID:N/A
tRFdb ID:N/A



tsRNA Association Statistics

Total Associated Disease Number:2
More Information
Network:
(Display the first 15 nodes)



Disease Information

 MeSHDisease Ontology
Disease ID:D000075322N/A
Disease Name:Heavy Metal PoisoningN/A
Category:MeSHDisease Ontology
Type:Chemically-Induced DisordersN/A
Define:Poisoning that results from chronic or acute ingestion, injection, inhalation, or skin absorption of HEAVY METALS. Acute and chronic exposures can cause ANEMIA; KIDNEY and LIVER damage; PULMONARY EDEMA; MEMORY LOSS and behavioral changes; bone deformities in children; and MISCARRIAGE or PREMATURE LABOR in pregnant women.N/A
Alias:N/AN/A



Disease Association Statistics

Total Associated tsRNA Number:78
More Information
Network:
(Display the first 15 nodes)



Evidence Support

Strong Evidence:RT-PCR
Weak Evidence:High-throughput sequencing



Reference

[1] PubMed ID:30442959
Disease Name:Heavy Metal Poisoning
Tissue:A549 Cells (Human Alveolar Type Ii-Like Epithelial Cells)
Dysfunction Pattern:Up-Regulation
Validated Method:RT-PCR//High-throughput sequencing
Description:We identified that p65, an important transcription factor belonging to NF-κB family and also a key factor controlling inflammatory gene expression, is a regulated target of a tRF derived from 5'-end of mature tRNA encoding AlaCGC (tRF5-AlaCGC).
Comparision:Treatment VS Control
Mechanism:tRF5AlaCGC activates p65, subsequently leading to enhanced secretion of IL-8 in arsenite response.