Entry Detail



General Information

Database ID:TRD02454
Confidence:High
Contents:>> tsRNA Information
>> tsRNA Association Statistics
>> Disease Information
>> Disease Association Statistics
>> Evidence Support
>> Reference



tsRNA Information

tsRNA Name:tRF-Phe-GAA-001
tsRNA Type:tRF-3
Amino acid and Anticodon:PheGAA
Sequence:TATATACCCGGGTTTCGGCACCA
Related Target:N/A
Predicted Target:NFATC3//NFE4//PKN3//LRP10//CSMD2//PHF20//TUBA4A//HAGHL//TNFSF12-TNFSF13//TNFSF13
External Links:
MINTbase ID:tRF-34-PSQP4PW3FJI0EJ
tRFdb ID:tRFdb-3023a



tsRNA Association Statistics

Total Associated Disease Number:23
More Information
Network:
(Display the first 15 nodes)



Disease Information

 MeSHDisease Ontology
Disease ID:D003920DOID:9351
Disease Name:Diabetes Mellitusdiabetes mellitus
Category:MeSHDisease Ontology
Type:Nutritional and Metabolic Diseases//Endocrine System Diseasesdisease of metabolism//genetic disease
Define:A heterogeneous group of disorders characterized by HYPERGLYCEMIA and GLUCOSE INTOLERANCE.A glucose metabolism disease that is characterized by chronic hyperglycaemia with disturbances of carbohydrate, fat and protein metabolism resulting from defects in insulin secretion, insulin action, or both.
Alias:N/AN/A



Disease Association Statistics

Total Associated tsRNA Number:47
More Information
Network:
(Display the first 15 nodes)



Evidence Support

Strong Evidence:RT-PCR
Weak Evidence:High-throughput sequencing



Reference

[1] PubMed ID:36760596
Disease Name:Diabetes Mellitus
Tissue:Skin
Dysfunction Pattern:Up-Regulation
Validated Method:RT-PCR//High-throughput sequencing
Description:Among them, tRF-Gly-CCC-039 and tRF-Phe-GAA-001 were significantly upregulated in the diabetes group, and tRF-Val-CAC-007, tiRNA-Pro-CGG-001, and tiRNA-Val-CAC-003 were significantly downregulated in the diabetes group compared with the control group (Figure 3A).
Comparision:Disease VS Control
Mechanism:High glucose disturbed endothelial function in HUVECs, and tRF-Gly-CCC-039 mimics further harmed HUVECs function, characterized by the suppression of proliferation, migration, tube formation, and the expression of Coll1a1, Coll4a2, and MMP9. Conversely, the tRF-Gly-CCC-039 inhibitor could attenuate high-glucose-induced endothelial injury to HUVECs.