Entry Detail



General Information

Database ID:TRD02202
Confidence:High
Contents:>> tsRNA Information
>> tsRNA Association Statistics
>> Disease Information
>> Disease Association Statistics
>> Evidence Support
>> Reference



tsRNA Information

tsRNA Name:tRF-Gly-CCC-046
tsRNA Type:tRF-3
Amino acid and Anticodon:GlyCCC
Sequence:TATATATTCCCGGGCGGCGC
Related Target:N/A
Predicted Target:HAAO//HOMER2//RASSF7//ENTPD2//TRIM58//TET1//MC1R//ZC3H18//ANO7//ICAM5
External Links:
MINTbase ID:N/A
tRFdb ID:N/A



tsRNA Association Statistics

Total Associated Disease Number:2
More Information
Network:
(Display the first 15 nodes)



Disease Information

 MeSHDisease Ontology
Disease ID:D001943DOID:1612
Disease Name:Breast Neoplasmsbreast cancer
Category:MeSHDisease Ontology
Type:Neoplasms//Skin and Connective Tissue Diseasesdisease of anatomical entity//disease of cellular proliferation
Define:Tumors or cancer of the human BREAST.A thoracic cancer that originates in the mammary gland.
Alias:Breast Cancer//Breast Carcinoma//Breast Tumors//Cancer of Breast//Cancer of the Breast//Human Mammary Carcinoma//Malignant Neoplasm of Breast//Malignant Tumor of Breast//Mammary Cancer//Mammary Carcinoma, Human//Mammary Neoplasm, Human//Mammary Neoplasms, Human//Neoplasms, Breast//Tumors, Breastbreast tumor//malignant neoplasm of breast//malignant tumor of the breast//mammary cancer//mammary neoplasm//mammary tumor//primary breast cancer



Disease Association Statistics

Total Associated tsRNA Number:549
More Information
Network:
(Display the first 15 nodes)



Evidence Support

Strong Evidence:RT-PCR
Weak Evidence:High-throughput sequencing//Data Mining



Reference

[1] PubMed ID:34254739
Disease Name:Breast Neoplasms
Tissue:Breast Cancer
Dysfunction Pattern:Down-Regulation
Validated Method:RT-PCR//High-throughput sequencing//Data Mining
Description:Our results demonstrated that tRFs: tRF-Gly-CCC-046,tRF-Tyr-GTA-010 and tRF-Pro-TGG-001 were downregulated in both tissues and sera from breast cancer patients as well as early-stage patients compared with those in the healthy donors.
Comparision:Cancer VS Normal
Mechanism:N/A