Entry Detail


General Information

Database ID:TRD02103
Confidence:High
Contents:>> tsRNA Information
>> tsRNA Association Statistics
>> Disease Information
>> Disease Association Statistics
>> Evidence Support
>> Reference



tsRNA Information

tsRNA Name:tRF-22-8BWS7K092
tsRNA Type:tRF-3
Amino acid and Anticodon:GlnTTG
Sequence:TCAAATCTCGGTGGGACTCCA
Related Target:Hippo
Predicted Target:HIVEP3//TOR3A//KRBA1//NOVA1//ZNF510//SLC4A8//ELN//ZMYM4//WDR33//TBCC
External Links:
MINTbase ID:N/A
tRFdb ID:N/A



tsRNA Association Statistics

Total Associated Disease Number:4
More Information
Network:
(Display the first 15 nodes)



Disease Information

 MeSHDisease Ontology
Disease ID:D055371N/A
Disease Name:Acute Lung InjuryN/A
Category:MeSHDisease Ontology
Type:Respiratory Tract DiseasesN/A
Define:A condition of lung damage that is characterized by bilateral pulmonary infiltrates (PULMONARY EDEMA) rich in NEUTROPHILS, and in the absence of clinical HEART FAILURE. This can represent a spectrum of pulmonary lesions, endothelial and epithelial, due to numerous factors (physical, chemical, or biological).N/A
Alias:Lung Injury, AcuteN/A



Disease Association Statistics

Total Associated tsRNA Number:109
More Information
Network:
(Display the first 15 nodes)



Evidence Support

Strong Evidence:RT-PCR
Weak Evidence:High-throughput sequencing



Reference

[1] PubMed ID:35299002
Disease Name:Acute Lung Injury
Tissue:AM-Derived Exosomal tRFs in ALI
Dysfunction Pattern:Up-Regulation
Validated Method:RT-PCR//High-throughput sequencing
Description:Alveolar macrophage-derived exosomal tRF-22-8BWS7K092 activates Hippo signaling pathway to induce ferroptosis in acute lung injury.
Comparision:Disease VS Control
Mechanism:tRF-22-8BWS7K092 could activate Hippo signaling pathway by binding Wnt5B, inducing ferroptosis in MLE-12 cells.