Entry Detail


General Information

Database ID:TRD01810
Confidence:Median
Contents:>> tsRNA Information
>> tsRNA Association Statistics
>> Disease Information
>> Disease Association Statistics
>> Evidence Support
>> Reference



tsRNA Information

tsRNA Name:ts-19
tsRNA Type:tRF-1
Amino acid and Anticodon:ValCAC
Sequence:CCTCCTGAGACTATTTCTCCTTCCCAACATTT
Related Target:N/A
Predicted Target:NPHP4//BRMS1//MCTP2//PDZD4//WDFY2//AL121578.2//GSG1//FADS2//UGP2//MEIS2
External Links:
MINTbase ID:N/A
tRFdb ID:ts-19



tsRNA Association Statistics

Total Associated Disease Number:1
More Information
Network:
(Display the first 15 nodes)



Disease Information

 MeSHDisease Ontology
Disease ID:D001943DOID:1612
Disease Name:Breast Neoplasmsbreast cancer
Category:MeSHDisease Ontology
Type:Neoplasms//Skin and Connective Tissue Diseasesdisease of anatomical entity//disease of cellular proliferation
Define:Tumors or cancer of the human BREAST.A thoracic cancer that originates in the mammary gland.
Alias:Breast Cancer//Breast Carcinoma//Breast Tumors//Cancer of Breast//Cancer of the Breast//Human Mammary Carcinoma//Malignant Neoplasm of Breast//Malignant Tumor of Breast//Mammary Cancer//Mammary Carcinoma, Human//Mammary Neoplasm, Human//Mammary Neoplasms, Human//Neoplasms, Breast//Tumors, Breastbreast tumor//malignant neoplasm of breast//malignant tumor of the breast//mammary cancer//mammary neoplasm//mammary tumor//primary breast cancer



Disease Association Statistics

Total Associated tsRNA Number:549
More Information
Network:
(Display the first 15 nodes)



Evidence Support

Strong Evidence:N/A
Weak Evidence:Microarray



Reference

[1] PubMed ID:31919859
Disease Name:Breast Neoplasms
Tissue:N/A
Dysfunction Pattern:Down-Regulation
Validated Method:Microarray
Description:In sum, these experiments demonstrate that loss of RUNX1 coincides with changes in the expression levels of four tsRNA; ts-19 and ts-29 show positive correlation with reduced expression after RUNX1 knock-down and ts-46 and ts-112 show negative correlation with reciprocal expression to RUNX1 knock-down or overexpression, respectively.
Comparision:N/A
Mechanism:N/A