Entry Detail



General Information

Database ID:TRD01782
Confidence:High
Contents:>> tsRNA Information
>> tsRNA Association Statistics
>> Disease Information
>> Disease Association Statistics
>> Evidence Support
>> Reference



tsRNA Information

tsRNA Name:tRF-1035
tsRNA Type:tRF-1
Amino acid and Anticodon:ThrCGT
Sequence:GATATCCAACCTTCGGCTATAGGGTGGAGACTTTTT
Related Target:N/A
Predicted Target:PSG1//ADCK2//PLRG1//MAJIN//EFCAB2//MSH2//CELF3//FREM2//IZUMO4//MIEN1
External Links:
MINTbase ID:N/A
tRFdb ID:tRFdb-1035



tsRNA Association Statistics

Total Associated Disease Number:6
More Information
Network:
(Display the first 15 nodes)



Disease Information

 MeSHDisease Ontology
Disease ID:D008180DOID:9074
Disease Name:Lupus Erythematosus, Systemicsystemic lupus erythematosus
Category:MeSHDisease Ontology
Type:Skin and Connective Tissue Diseases//Immune System Diseasesdisease of anatomical entity
Define:A chronic, relapsing, inflammatory, and often febrile multisystemic disorder of connective tissue, characterized principally by involvement of the skin, joints, kidneys, and serosal membranes. It is of unknown etiology, but is thought to represent a failure of the regulatory mechanisms of the autoimmune system. The disease is marked by a wide range of system dysfunctions, an elevated erythrocyte sedimentation rate, and the formation of LE cells in the blood or bone marrow.A lupus erythematosus that is an inflammation of connective tissue marked by skin rashes, joint pain and swelling, inflammation of the kidneys and inflammation of the tissue surrounding the heart.
Alias:Libman-Sacks Disease//Lupus Erythematosus Disseminatus//Systemic Lupus Erythematosusdisseminated lupus erythematosus//Lupus Erythematosus, systemic//SLE - Lupus Erythematosus, systemic



Disease Association Statistics

Total Associated tsRNA Number:111
More Information
Network:
(Display the first 15 nodes)



Evidence Support

Strong Evidence:RT-PCR
Weak Evidence:High-throughput sequencing



Reference

[1] PubMed ID:34256772
Disease Name:Lupus Erythematosus, Systemic
Tissue:Cd7+ T Cells From Patients With Systemic Lupus Erythematosus
Dysfunction Pattern:Down-Regulation
Validated Method:RT-PCR//High-throughput sequencing
Description:N/A
Comparision:Disease VS Control
Mechanism:N/A