Entry Detail


General Information

Database ID:TRD01752
Confidence:Median
Contents:>> tsRNA Information
>> tsRNA Association Statistics
>> Disease Information
>> Disease Association Statistics
>> Evidence Support
>> Reference



tsRNA Information

tsRNA Name:ts-112
tsRNA Type:tRF-1
Amino acid and Anticodon:SerGCT
Sequence:CTCGGCTTTCCCTGCTAACTGGGCTTT
Related Target:N/A
Predicted Target:NPIPB7//NPIPB9//NPIPB8//AC138894.1//NPIPB15//NPIPB6//STC2//ZNF319//NUMBL//AGAP2
External Links:
MINTbase ID:N/A
tRFdb ID:ts-112



tsRNA Association Statistics

Total Associated Disease Number:1
More Information
Network:
(Display the first 15 nodes)



Disease Information

 MeSHDisease Ontology
Disease ID:D001943DOID:1612
Disease Name:Breast Neoplasmsbreast cancer
Category:MeSHDisease Ontology
Type:Neoplasms//Skin and Connective Tissue Diseasesdisease of anatomical entity//disease of cellular proliferation
Define:Tumors or cancer of the human BREAST.A thoracic cancer that originates in the mammary gland.
Alias:Breast Cancer//Breast Carcinoma//Breast Tumors//Cancer of Breast//Cancer of the Breast//Human Mammary Carcinoma//Malignant Neoplasm of Breast//Malignant Tumor of Breast//Mammary Cancer//Mammary Carcinoma, Human//Mammary Neoplasm, Human//Mammary Neoplasms, Human//Neoplasms, Breast//Tumors, Breastbreast tumor//malignant neoplasm of breast//malignant tumor of the breast//mammary cancer//mammary neoplasm//mammary tumor//primary breast cancer



Disease Association Statistics

Total Associated tsRNA Number:549
More Information
Network:
(Display the first 15 nodes)



Evidence Support

Strong Evidence:N/A
Weak Evidence:Microarray



Reference

[1] PubMed ID:31919859
Disease Name:Breast Neoplasms
Tissue:Mcf10 Cell Line
Dysfunction Pattern:Up-Regulation
Validated Method:Microarray
Description:Our finding that ts-112 and RUNX1 anti-correlate in normal-like mammary epithelial and breast cancer lines is consistent with tumor-related activity of ts-112 and tumor suppressor activity of RUNX1.
Comparision:Cancer VS Normal
Mechanism:Our finding that ts‐112 and RUNX1 anticorrelate in normal‐like mammary epithelial and breast cancer lines is consistent with tumor‐related activity of ts‐112 and tumor suppressor activity of RUNX1. Inhibition of ts‐112 in MCF10CA1a aggressive breast cancer cells significantly reduced proliferation. Ectopic expression of a ts‐112 mimic in normal‐like mammary epithelial MCF10A cells significantly increased proliferation. These findings support an oncogenic potential for ts‐112. Moreover, RUNX1 may repress ts‐112 to prevent overactive proliferation in breast epithelial cells to augment its established roles in maintaining the mammary epithelium.