Entry Detail



General Information

Database ID:TRD01724
Confidence:Median
Contents:>> tsRNA Information
>> tsRNA Association Statistics
>> Disease Information
>> Disease Association Statistics
>> Evidence Support
>> Reference



tsRNA Information

tsRNA Name:tRF-+1:T21-Leu-TAG-3
tsRNA Type:tRF-1
Amino acid and Anticodon:LeuTAG
Sequence:CACCTCAGAAGGTCTCACTTT
Related Target:N/A
Predicted Target:PALM2-AKAP2//ICE1//JADE3//EXOC6B//USP46//C12orf49//PAQR8//ZNF26//LIPC//TECTA
External Links:
MINTbase ID:N/A
tRFdb ID:N/A



tsRNA Association Statistics

Total Associated Disease Number:2
More Information
Network:
(Display the first 15 nodes)



Disease Information

 MeSHDisease Ontology
Disease ID:D001749DOID:4006
Disease Name:Urinary Bladder Neoplasmsbladder urothelial carcinoma
Category:MeSHDisease Ontology
Type:Neoplasms//Urogenital Diseasesdisease of cellular proliferation//disease of anatomical entity
Define:Tumors or cancer of the URINARY BLADDER.A bladder carcinoma that has_material_basis_in transitional cells located_in the lining of the bladder.
Alias:Bladder Cancer//Bladder Neoplasms//Bladder Tumors//Cancer of Bladder//Cancer of the Bladder//Malignant Tumor of Urinary Bladder//Neoplasms, Bladder//Urinary Bladder Cancerbladder transitional cell carcinoma//transitional cell carcinoma of bladder//urinary bladder urothelial carcinoma//urothelial bladder carcinoma



Disease Association Statistics

Total Associated tsRNA Number:41
More Information
Network:
(Display the first 15 nodes)



Evidence Support

Strong Evidence:N/A
Weak Evidence:High-throughput sequencing//Data Mining



Reference

[1] PubMed ID:35456407
Disease Name:Urinary Bladder Neoplasms
Tissue:bladder
Dysfunction Pattern:Down-Regulation
Validated Method:High-throughput sequencing//Data Mining
Description:Compared with paracancerous tissue, in tumor tissue, tiRNA-1:33-Gly-GCC-1 (p-value < 0.01) and tRF-1:32-Gly-GCC-1 (p-value < 0.01) were significantly upregulated, and tRF-+1:T20-Ser-TGA-1 (p-value < 0.01) was significantly downregulated, while tiRNA-1:34-Val-CAC-2 (p-value = 0.0568) was overexpressed without reaching statistical significance.
Comparision:Tumor VS Paracancer
Mechanism:N/A