Entry Detail



General Information

Database ID:TRD01719
Confidence:High
Contents:>> tsRNA Information
>> tsRNA Association Statistics
>> Disease Information
>> Disease Association Statistics
>> Evidence Support
>> Reference



tsRNA Information

tsRNA Name:tRF-+1:T25-Leu-CAG-1-6
tsRNA Type:tRF-1
Amino acid and Anticodon:LeuCAG
Sequence:ATATGTGTTTTCCGTCCTTACTTTT
Related Target:N/A
Predicted Target:PTPRG//ADGRL4//ENC1//PITPNA//RMDN3//SMARCB1//SLC8A3//CASC3//PHIP//BCL2L11
External Links:
MINTbase ID:N/A
tRFdb ID:N/A



tsRNA Association Statistics

Total Associated Disease Number:11
More Information
Network:
(Display the first 15 nodes)



Disease Information

 MeSHDisease Ontology
Disease ID:D055370N/A
Disease Name:Lung InjuryN/A
Category:MeSHDisease Ontology
Type:Respiratory Tract Diseases//Wounds and InjuriesN/A
Define:Damage to any compartment of the lung caused by physical, chemical, or biological agents which characteristically elicit inflammatory reaction. These inflammatory reactions can either be acute and dominated by NEUTROPHILS, or chronic and dominated by LYMPHOCYTES and MACROPHAGES.N/A
Alias:Chronic Lung Injury//E-Cigarette Use-Associated Lung Injury//E-Cigarette or Vaping Product Use-Associated Lung Injury//EVALI//Lung Injuries//Pulmonary Injury//Vaping Product Use-Associated Lung InjuryN/A



Disease Association Statistics

Total Associated tsRNA Number:81
More Information
Network:
(Display the first 15 nodes)



Evidence Support

Strong Evidence:RT-PCR
Weak Evidence:High-throughput sequencing//Data Mining



Reference

[1] PubMed ID:36176737
Disease Name:Lung Injury
Tissue:Human Bronchial Epithelial Cells
Dysfunction Pattern:Down-Regulation
Validated Method:RT-PCR//High-throughput sequencing//Data Mining
Description:In the irradiation and control groups, the top ten most upregulated or downregulated tRFs after irradiation are listed in Table 2. To further verify the accuracy of the sequencing results, we randomly selected nine upregulated tRFs with significant differential expression and high expression abundance in each sample as candidate tRFs for qRT-PCR (Figure 9D).
Comparision:Disease VS Control
Mechanism:N/A