Entry Detail



General Information

Database ID:TRD01716
Confidence:High
Contents:>> tsRNA Information
>> tsRNA Association Statistics
>> Disease Information
>> Disease Association Statistics
>> Evidence Support
>> Reference



tsRNA Information

tsRNA Name:ts-26
tsRNA Type:tRF-1
Amino acid and Anticodon:LeuCAA
Sequence:CAACTATCTTATTCTCCTTT
Related Target:N/A
Predicted Target:MYH11//MTURN//RIOK3//OTUD6B//PRPF38A//MYOF//KDM7A//BPTF//MAGED4//MAGED4B
External Links:
MINTbase ID:N/A
tRFdb ID:ts-26



tsRNA Association Statistics

Total Associated Disease Number:1
More Information
Network:
(Display the first 15 nodes)



Disease Information

 MeSHDisease Ontology
Disease ID:D000080443DOID:0080880
Disease Name:Diffuse Intrinsic Pontine Gliomadiffuse glioma, H3 G34 mutant
Category:MeSHDisease Ontology
Type:Neoplasms//Nervous System Diseasesdisease of cellular proliferation
Define:Nervous System DiseasesA histone mutated tumor that has_material_basis_in mutations in codon 34 of the H3 histone family 3A protein.
Alias:DIPG Brain Tumors//DIPG, Diffuse Intrinsic Pontine GliomaN/A



Disease Association Statistics

Total Associated tsRNA Number:35
More Information
Network:
(Display the first 15 nodes)



Evidence Support

Strong Evidence:RT-PCR
Weak Evidence:Data Mining



Reference

[1] PubMed ID:36072386
Disease Name:Diffuse Intrinsic Pontine Glioma
Tissue:Brain
Dysfunction Pattern:Down-Regulation
Validated Method:RT-PCR//Data Mining
Description:Among the tsRNAs derived from tRNA-Leu-CAA, ts-26, tRFdb-3012a, and tRFdb-3012b (tRFdb-3012a/b) were significantly decreased in diffuse gliomas.
Comparision:Cancer VS Normal
Mechanism:Expression of tRFdb-3012a/b was correlated with IDH mutant status and MGMT promoter mutation in gliomas, and tRFdb-3012a/b and ts-23 tended to be highly expressed in patients with the IDH mutant. The enrichment analysis showed that some tRFdb-3012a/b-related genes were enriched in RNA splicing and processing, the spliceosome pathway and astrocyte molecular signatures. Moreover, the 3′ untranslated region of the RBM43 gene was predicted to contain putative binding sites of tRFdb-3012a/b, ts-26 may directly bind to the 3′ untranslated region of the HOXA13 gene, and the expressions of both RBM43 and HOXA13 were up-regulated in diffuse gliomas. High RBM43 and HOXA13 expressions were significantly associated with poor survival outcome of glioma patients.