Entry Detail



General Information

Database ID:TRD01649
Confidence:Median
Contents:>> tsRNA Information
>> tsRNA Association Statistics
>> Disease Information
>> Disease Association Statistics
>> Evidence Support
>> Reference



tsRNA Information

tsRNA Name:tRF-Arg-TCT-027
tsRNA Type:tRF-1
Amino acid and Anticodon:ArgTCT
Sequence:GTCACCTGGCAGGTGCCTCTTT
Related Target:N/A
Predicted Target:SH3KBP1//CCDC125//FBN3//COL4A1//ZNF805//RDH10//TTYH3//ARTN//CADPS2//VGLL4
External Links:
MINTbase ID:N/A
tRFdb ID:N/A



tsRNA Association Statistics

Total Associated Disease Number:1
More Information
Network:
(Display the first 15 nodes)



Disease Information

 MeSHDisease Ontology
Disease ID:D017719N/A
Disease Name:Diabetic FootN/A
Category:MeSHDisease Ontology
Type:Cardiovascular Diseases//Skin and Connective Tissue Diseases//Endocrine System DiseasesN/A
Define:Common foot problems in persons with DIABETES MELLITUS, caused by any combination of factors such as DIABETIC NEUROPATHIES; PERIPHERAL VASCULAR DISEASES; and INFECTION. With the loss of sensation and poor circulation, injuries and infections often lead to severe foot ulceration, GANGRENE and AMPUTATION, SURGICAL.N/A
Alias:Diabetic Feet//Foot Ulcer, DiabeticN/A



Disease Association Statistics

Total Associated tsRNA Number:277
More Information
Network:
(Display the first 15 nodes)



Evidence Support

Strong Evidence:N/A
Weak Evidence:High-throughput sequencing//Data Mining



Reference

[1] PubMed ID:34657473
Disease Name:Diabetic Foot
Tissue:Skin
Dysfunction Pattern:Up-Regulation
Validated Method:High-throughput sequencing//Data Mining
Description:In addition, 244 tsRNAs were confirmed to be dysregulated in DFU tissues: 178 tsRNAs were upregulated, whereas 66 tsRNAs were downregulated (DFU vs normal; FC >1.5 and p < 0.05; Figure 2D & Supplementary data 3).
Comparision:DFU VS Normal
Mechanism:N/A