Entry Detail


General Information

Database ID:TRD01610
Confidence:High
Contents:>> tsRNA Information
>> tsRNA Association Statistics
>> Disease Information
>> Disease Association Statistics
>> Evidence Support
>> Reference



tsRNA Information

tsRNA Name:Gly-tRF
tsRNA Type:i-tRF
Amino acid and Anticodon:N/A
Sequence:GCGAGAATTCTACCACTGAACCACCAATGC
Related Target:NDFIP2
Predicted Target:PBX2//KRT1//BNIP1//ATP6AP2//CLCN6//SNX22//MYBPC3//DEXI//GPAT4//LAX1
External Links:
MINTbase ID:N/A
tRFdb ID:N/A



tsRNA Association Statistics

Total Associated Disease Number:3
More Information
Network:
(Display the first 15 nodes)



Disease Information

 MeSHDisease Ontology
Disease ID:D006528DOID:684
Disease Name:Carcinoma, Hepatocellularhepatocellular carcinoma
Category:MeSHDisease Ontology
Type:Neoplasms//Digestive System Diseasesdisease of anatomical entity//disease of cellular proliferation
Define:A primary malignant neoplasm of epithelial liver cells. It ranges from a well-differentiated tumor with EPITHELIAL CELLS indistinguishable from normal HEPATOCYTES to a poorly differentiated neoplasm. The cells may be uniform or markedly pleomorphic, or form GIANT CELLS. Several classification schemes have been suggested.A liver carcinoma that has_material_basis_in undifferentiated hepatocytes and located_in the liver.
Alias:Hepatocellular Carcinoma//Hepatoma//Liver Cancer, Adult//Liver Cell Carcinoma//Liver Cell Carcinoma, AdultHepatoma



Disease Association Statistics

Total Associated tsRNA Number:61
More Information
Network:
(Display the first 15 nodes)



Evidence Support

Strong Evidence:RT-PCR
Weak Evidence:High-throughput sequencing



Reference

[1] PubMed ID:34537070
Disease Name:Carcinoma, Hepatocellular
Tissue:Tumor Tissue
Dysfunction Pattern:Up-Regulation
Validated Method:RT-PCR//High-throughput sequencing
Description:Nedd4 family interacting protein 2.
Comparision:Cancer VS Normal
Mechanism:Gly-tRF enhances LCSC-like cell properties and promotes EMT by targeting NDFIP2 and activating the AKT signalling pathway. Gly-tRF plays tumor-promoting role in HCC and may lead to a potential therapeutic target for HCC.