tsRNADisease

Entry Detail

General Information

Database ID:	TRD01604
Confidence:	Median
Contents:	>> tsRNA Information >> tsRNA Association Statistics >> Disease Information >> Disease Association Statistics >> Evidence Support >> Reference

tsRNA Information

tsRNA Name:

AS-tDR-016258

tsRNA Type:

i-tRF

Amino acid and Anticodon:

N/A

Sequence:

CTTAGTTGGTTAAAGCGCCTGT

Related Target:

Plpp3; Spred1; Fyn; Rnf139; Rbm24; Kcnq5; Lrp1; Tex21; Slc38a2; Lrrc19; Tmem165; Arpp19; Gfap; B3galt2; Lrif1; Rbms1; Asf1a; Ubl3; Zhx3; Sema6d; Kcnb2; Nkrf; Aebp2

Predicted Target:

RPA4//SLC2A4//HSPBP1//DNAH3//SRP54//RFX1//SPEN//LAP3//GCSAM//AC025283.2

External Links:

MINTbase ID:	N/A
tRFdb ID:	N/A

tsRNA Association Statistics

Total Associated Disease Number:	1 More Information
Network: (Display the first 15 nodes)

Disease Information

	MeSH	Disease Ontology
Disease ID:	D009404	N/A
Disease Name:	Nephrotic Syndrome	N/A
Category:	MeSH	Disease Ontology
Type:	N/A	N/A
Define:	N/A	N/A
Alias:	Congenital nephrotic syndrome 1//Congenital nephrotic syndrome, Finnish type//Finnish congenital nephrosis//Nephrosis 1, congenital, Finnish type//Nephrotic Syndrome, Early-Onset, Type 3//Nephrotic Syndrome, Idiopathic//Nephrotic Syndrome, Type 1//Nephrotic Syndrome, Type 2//Nephrotic Syndrome, Type 3//Nphs3	N/A

Disease Association Statistics

Total Associated tsRNA Number:	209 More Information
Network: (Display the first 15 nodes)

Evidence Support

Strong Evidence:	N/A
Weak Evidence:	High-throughput sequencing

Reference

[1] PubMed ID:	32685525
Disease Name:	Nephrotic Syndrome
Tissue:	Podocyte
Dysfunction Pattern:	Up-Regulation
Validated Method:	High-throughput sequencing
Description:	N/A
Comparision:	Adriamycin-treated Group VS None
Mechanism:	N/A