Entry Detail



General Information

Database ID:TRD01541
Confidence:High
Contents:>> tsRNA Information
>> tsRNA Association Statistics
>> Disease Information
>> Disease Association Statistics
>> Evidence Support
>> Reference



tsRNA Information

tsRNA Name:tRF-20-V25Z2IUI
tsRNA Type:i-tRF
Amino acid and Anticodon:ValTAC
Sequence:TAGGAGATTTCAACTTAACT
Related Target:N/A
Predicted Target:KXD1//MCOLN2//MGAM//TSPAN3//OAZ3//SETD7//PDE6A//SYNE2//SYTL2//CLCN4
External Links:
MINTbase ID:tRF-20-V25Z2IUI
tRFdb ID:N/A

[1] gtRNAdb_ID:-
Anticodon:ValTAC
tRNA_number:trnaMT
Chromosome:MT
Strand:+
Coordinate:Start Site(bp): 1639        End Site(bp): 1658



tsRNA Association Statistics

Total Associated Disease Number:1
More Information
Network:
(Display the first 15 nodes)



Disease Information

 MeSHDisease Ontology
Disease ID:D015451DOID:1040
Disease Name:Leukemia, Lymphocytic, Chronic, B-Cellchronic lymphocytic leukemia
Category:MeSHDisease Ontology
Type:Neoplasms//Hemic and Lymphatic Diseases//Immune System Diseases//Pathological Conditions, Signs and Symptomsdisease of anatomical entity//disease of cellular proliferation
Define:A chronic leukemia characterized by abnormal B-lymphocytes and often generalized lymphadenopathy. In patients presenting predominately with blood and bone marrow involvement it is called chronic lymphocytic leukemia (CLL); in those predominately with enlarged lymph nodes it is called small lymphocytic lymphoma. These terms represent spectrums of the same disease.A lymphocytic leukemia characterized by over production of B-cells and their accumulation in bone marrow and blood.
Alias:B-Cell Chronic Lymphocytic Leukemia//B-Cell Leukemia, Chronic//B-Cell Malignancy, Low-Grade//B-Lymphocytic Leukemia, Chronic//Chronic Lymphocytic Leukemia//Diffuse Well-Differentiated Lymphocytic Lymphoma//Disrupted In B-Cell Malignancy//Leukemia, B Cell, Chronic//Leukemia, B-Cell, Chronic//Leukemia, Chronic Lymphatic//Leukemia, Chronic Lymphocytic//Leukemia, Chronic Lymphocytic, B-Cell//Leukemia, Lymphoblastic, Chronic//Leukemia, Lymphocytic, Chronic//Leukemia, Lymphocytic, Chronic, B Cell//Lymphoblastic Leukemia, Chronic//Lymphocytic Leukemia, Chronic//Lymphocytic Leukemia, Chronic, B Cell//Lymphocytic Leukemia, Chronic, B-Cell//Lymphocytic Lymphoma//Lymphocytic Lymphoma, Diffuse, Well Differentiated//Lymphocytic Lymphoma, Diffuse, Well-Differentiated//Lymphocytic Lymphoma, Well Differentiated//Lymphocytic Lymphoma, Well-Differentiated//Lymphoma, Lymphocytic//Lymphoma, Lymphocytic, Diffuse, Well Differentiated//Lymphoma, Lymphocytic, Diffuse, Well-Differentiated//Lymphoma, Lymphocytic, Well Differentiated//Lymphoma, Lymphocytic, Well-Differentiated//Lymphoma, Lymphoplasmacytoid, CLL//Lymphoma, Small Lymphocytic//Lymphoma, Small Lymphocytic, Plasmacytoid//Lymphoma, Small-Cell//Lymphoplasmacytoid Lymphoma, CLL//Small-Cell LymphomaB-cell chronic lymphocytic leukaemia//B-cell chronic lymphocytic leukemia//B-cell chronic lymphoid leukemia//chronic lymphatic leukaemia//chronic lymphatic leukemia//chronic lymphocytic leukaemia//CLL//lymphoplasmacytic leukaemia//lymphoplasmacytic leukemia



Disease Association Statistics

Total Associated tsRNA Number:1731
More Information
Network:
(Display the first 15 nodes)



Evidence Support

Strong Evidence:RT-PCR
Weak Evidence:High-throughput sequencing



Reference

[1] PubMed ID:31723042
Disease Name:Leukemia, Lymphocytic, Chronic, B-Cell
Tissue:B Cells
Dysfunction Pattern:Up-Regulation
Validated Method:RT-PCR//High-throughput sequencing
Description:N/A
Comparision:CLL VS Normal
Mechanism:We further analyzed the expression of mature tRFs and found that mature tRFs are drastically dysregulated in CLL. Thus, we conclude that tsRNAs and mature tRFs, 2 classes of small noncoding RNAs, may be associated with the development of CLL.