Entry Detail



General Information

Database ID:TRD01283
Confidence:High
Contents:>> tsRNA Information
>> tsRNA Association Statistics
>> Disease Information
>> Disease Association Statistics
>> Evidence Support
>> Reference



tsRNA Information

tsRNA Name:mt-Met-CAT
tsRNA Type:i-tRF
Amino acid and Anticodon:MetCAT
Sequence:TAAGCTATCGGGCCCATACCCCGAAAACGTTGGTTT
Related Target:N/A
Predicted Target:E2F4//CNTN2//SLC5A10//PLK4//KIAA0232//PEX16//IRF3//PTPRJ//ELAC2//SHISA5
External Links:
MINTbase ID:N/A
tRFdb ID:N/A



tsRNA Association Statistics

Total Associated Disease Number:1
More Information
Network:
(Display the first 15 nodes)



Disease Information

 MeSHDisease Ontology
Disease ID:D003922DOID:9744
Disease Name:Diabetes Mellitus, Type 1type 1 diabetes mellitus
Category:MeSHDisease Ontology
Type:Nutritional and Metabolic Diseases//Endocrine System Diseases //Immune System Diseasesdisease of anatomical entity//immune system disease//disease of metabolism//genetic disease
Define:A subtype of DIABETES MELLITUS that is characterized by INSULIN deficiency. It is manifested by the sudden onset of severe HYPERGLYCEMIA, rapid progression to DIABETIC KETOACIDOSIS, and DEATH unless treated with insulin. The disease may occur at any age, but is most common in childhood or adolescence.A diabetes mellitus that is characterized by destruction of pancreatic beta cells resulting in absent or extremely low insulin production.
Alias:Autoimmune Diabetes//Diabetes Mellitus, Brittle//Diabetes Mellitus, Insulin-Dependent//Diabetes Mellitus, Insulin-Dependent, 1//Diabetes Mellitus, Juvenile-Onset//Diabetes Mellitus, Ketosis-Prone//Diabetes Mellitus, Sudden-Onset//Diabetes Mellitus Type //Diabetes, Autoimmune//IDDM//Insulin-Dependent Diabetes Mellitus 1//Juvenile-Onset Diabetes//Type 1 Diabetes//Type 1 Diabetes MellitusIDDM//insulin-dependent diabetes mellitus//type I diabetes mellitus [EXACT]



Disease Association Statistics

Total Associated tsRNA Number:3
More Information
Network:
(Display the first 15 nodes)



Evidence Support

Strong Evidence:RT-PCR
Weak Evidence:High-throughput sequencing



Reference

[1] PubMed ID:38967669
Disease Name:Diabetes Mellitus, Type 1
Tissue:Pancreas
Dysfunction Pattern:N/A
Validated Method:RT-PCR//High-throughput sequencing
Description:We found that the tRF pool was altered in the islets of NOD mice during the initial phases of type 1 diabetes. Part of these changes were triggered by prolonged exposure of beta cells to proinflammatory cytokines (IL-1β, TNF-α and IFN-γ) while others resulted from the delivery of tRFs produced by CD5+ T lymphocytes infiltrating the islets.
Comparision:N/A
Mechanism:We identified several tRFs that were enriched in extracellular vesicles from CD4+/CD26− T cells and were transferred to beta cells upon adoptive transfer of these immune cells in NOD.SCID mice. The tRFs delivered to beta cells during the autoimmune reaction triggered gene expression changes that affected the immune regulatory capacity of insulin-secreting cells and rendered the cells more prone to apoptosis.