tsRNADisease

Entry Detail

General Information

Database ID:	TRD00906
Confidence:	Very High
Contents:	>> tsRNA Information >> tsRNA Association Statistics >> Disease Information >> Disease Association Statistics >> Evidence Support >> Reference

tsRNA Information

tsRNA Name:

tRF-47

tsRNA Type:

i-tRF

Amino acid and Anticodon:

GluTTC

Sequence:

GATGGTTTTTCATATCATTGGTCGTGGTTGTAGTCCGTGCGAGAATA

Related Target:

Predicted Target:

MYO10//SNX31//ARHGAP42//HDAC6//HNRNPH3//GART//RMND5A//UBR1//CLDN10//ELOF1

External Links:

MINTbase ID:	tRF-47-58ZZJQJYSWRYVMMV5BO
tRFdb ID:	N/A

[1] gtRNAdb_ID:	-
Anticodon:	GluTTC
tRNA_number:	trnaMT
Chromosome:	MT
Strand:	-
Coordinate:	Start Site(bp): 14674 End Site(bp): 14720

[2] gtRNAdb_ID:	-
Anticodon:	GluTTC
tRNA_number:	trnalookalike8
Chromosome:	5
Strand:	-
Coordinate:	Start Site(bp): 93905172 End Site(bp): 93905218

tsRNA Association Statistics

Total Associated Disease Number:	4 More Information
Network: (Display the first 15 nodes)

Disease Information

	MeSH	Disease Ontology
Disease ID:	D065626	DOID:0080546
Disease Name:	Non-alcoholic Fatty Liver Disease	non-alcoholic fatty liver
Category:	MeSH	Disease Ontology
Type:	Digestive System Diseases	disease of anatomical entity//disease of metabolism//genetic disease
Define:	Fatty liver finding without excessive ALCOHOL CONSUMPTION.	A metabolic dysfunction-associated steatotic liver disease characterized by the absence of inflammation and hepatocyte injury in the form of hepatocyte ballooning.
Alias:	Fatty Liver, Nonalcoholic//NAFLD//Nonalcoholic Fatty Liver Disease//Nonalcoholic Steatohepatitis	NAFL//nonalcoholic fatty liver

Disease Association Statistics

Total Associated tsRNA Number:	48 More Information
Network: (Display the first 15 nodes)

Evidence Support

Strong Evidence:	Transfection
Weak Evidence:	High-throughput sequencing

Reference

[1] PubMed ID:	35287671
Disease Name:	Non-alcoholic Fatty Liver Disease
Tissue:	Serum Samples
Dysfunction Pattern:	Up-Regulation
Validated Method:	Transfection//High-throughput sequencing
Description:	Then, small RNA sequencing revealed that TEC up-regulated the expression of tRF-47-58ZZJQJYSWRYVMMV5BO (tRF-47). The knockdown of tRF-47 blunted the beneficial effects of TEC on NASH in vitro, including inhibition of autophagy, activation of pyroptosis and release of inflammatory factors.
Comparision:	TEC VS Control
Mechanism:	These results demonstrated that tRF-47-mediated autophagy and pyroptosis plays a vital role in the function of TEC to treat NASH, suggesting that TEC may be a promising drug for the treatment of NASH.