Entry Detail


General Information

Database ID:TRD00629
Confidence:High
Contents:>> tsRNA Information
>> tsRNA Association Statistics
>> Disease Information
>> Disease Association Statistics
>> Evidence Support
>> Reference



tsRNA Information

tsRNA Name:tRF-21-NB8PLML3E
tsRNA Type:i-tRF
Amino acid and Anticodon:GlnCTG
Sequence:CGTAATCCAGCGATCCGAGTT
Related Target:N/A
Predicted Target:RTF1//DNAH7//TENT5B//NEURL1//MARVELD2//PPP1R9A//C1orf159//PCDHB14//NPHP4//NUDT21
External Links:
MINTbase ID:N/A
tRFdb ID:N/A



tsRNA Association Statistics

Total Associated Disease Number:5
More Information
Network:
(Display the first 15 nodes)



Disease Information

 MeSHDisease Ontology
Disease ID:D006332N/A
Disease Name:CardiomegalyN/A
Category:MeSHDisease Ontology
Type:Cardiovascular Diseases//Pathological Conditions, Signs and SymptomsN/A
Define:Enlargement of the HEART, usually indicated by a cardiothoracic ratio above 0.50. Heart enlargement may involve the right, the left, or both HEART VENTRICLES or HEART ATRIA. Cardiomegaly is a nonspecific symptom seen in patients with chronic systolic heart failure (HEART FAILURE) or several forms of CARDIOMYOPATHIES.N/A
Alias:Cardiac Hypertrophy//Enlarged Heart//Heart Enlargement//Heart HypertrophyN/A



Disease Association Statistics

Total Associated tsRNA Number:68
More Information
Network:
(Display the first 15 nodes)



Evidence Support

Strong Evidence:RT-PCR
Weak Evidence:High-throughput sequencing



Reference

[1] PubMed ID:37370960
Disease Name:Cardiomegaly
Tissue:Plasma
Dysfunction Pattern:Down-Regulation
Validated Method:RT-PCR//High-throughput sequencing
Description:N/A
Comparision:Disease VS Control
Mechanism:Data Mining revealed that the target genes of tRF-21-NB8PLML3E were mainly enriched in the metabolic pathway and involved in the regulation of ribosomes.