tsRNADisease

Entry Detail

General Information

Database ID:	TRD00595
Confidence:	High
Contents:	>> tsRNA Information >> tsRNA Association Statistics >> Disease Information >> Disease Association Statistics >> Evidence Support >> Reference

tsRNA Information

tsRNA Name:

tRF-30-JZOYJE22RR33

tsRNA Type:

i-tRF

Amino acid and Anticodon:

CysGCA

Sequence:

CATTTGACTGCAGATCAAGAGGTCCCCGGT

Related Target:

Predicted Target:

External Links:

MINTbase ID:	tRF-30-JZOYJE22RR33
tRFdb ID:	tRNA-Cys-GCA-25-1

tsRNA Association Statistics

Total Associated Disease Number:	1 More Information
Network: (Display the first 15 nodes)

Disease Information

	MeSH	Disease Ontology
Disease ID:	D001943	DOID:1612
Disease Name:	Breast Neoplasms	breast cancer
Category:	MeSH	Disease Ontology
Type:	Neoplasms//Skin and Connective Tissue Diseases	disease of anatomical entity//disease of cellular proliferation
Define:	Tumors or cancer of the human BREAST.	A thoracic cancer that originates in the mammary gland.
Alias:	Breast Cancer//Breast Carcinoma//Breast Tumors//Cancer of Breast//Cancer of the Breast//Human Mammary Carcinoma//Malignant Neoplasm of Breast//Malignant Tumor of Breast//Mammary Cancer//Mammary Carcinoma, Human//Mammary Neoplasm, Human//Mammary Neoplasms, Human//Neoplasms, Breast//Tumors, Breast	breast tumor//malignant neoplasm of breast//malignant tumor of the breast//mammary cancer//mammary neoplasm//mammary tumor//primary breast cancer

Disease Association Statistics

Total Associated tsRNA Number:	549 More Information
Network: (Display the first 15 nodes)

Evidence Support

Strong Evidence:	RT-PCR
Weak Evidence:	High-throughput sequencing//Data Mining

Reference

[1] PubMed ID:	30153663
Disease Name:	Breast Neoplasms
Tissue:	N/A
Dysfunction Pattern:	Up-Regulation
Validated Method:	RT-PCR//High-throughput sequencing//Data Mining
Description:	Our sequence results showed that tRNA-derived fragments were differentially expressed in the HBL-100,SKBR3,and JIMT-1 cell lines.
Comparision:	N/A
Mechanism:	N/A