Entry Detail


General Information

Database ID:TRD00410
Confidence:High
Contents:>> tsRNA Information
>> tsRNA Association Statistics
>> Disease Information
>> Disease Association Statistics
>> Evidence Support
>> Reference



tsRNA Information

tsRNA Name:tRF-20-M0NK5Y93
tsRNA Type:i-tRF
Amino acid and Anticodon:ArgCCG
Sequence:CGGAGCTGGGGATTGTGGGT
Related Target:Claudin1
Predicted Target:CDCP2//AL357673.1//MUC5B//TMEM150C//MUC12//C1orf159//SLC39A13//MAOA//MROH1//RILP
External Links:
MINTbase ID:tRF-20-M0NK5Y93
tRFdb ID:N/A

[1] gtRNAdb_ID:tRNA-Arg-CCG-2-1
Anticodon:ArgCCG
tRNA_number:trna23
Chromosome:17
Strand:-
Coordinate:Start Site(bp): 66016032        End Site(bp): 66016051



tsRNA Association Statistics

Total Associated Disease Number:12
More Information
Network:
(Display the first 15 nodes)



Disease Information

 MeSHDisease Ontology
Disease ID:D015179DOID:9256
Disease Name:Colorectal Neoplasmscolorectal cancer
Category:MeSHDisease Ontology
Type:Neoplasms//Digestive System Diseasesdisease of anatomical entity//disease of cellular proliferation
Define:Tumors or cancer of the COLON or the RECTUM or both. Risk factors for colorectal cancer include chronic ULCERATIVE COLITIS; FAMILIAL POLYPOSIS COLI; exposure to ASBESTOS; and irradiation of the CERVIX UTERI.A large intestine cancer that is located_in the colon and/or located_in the rectum.
Alias:Colorectal Cancer//Colorectal Carcinoma//Colorectal Tumors//Neoplasms, ColorectalN/A



Disease Association Statistics

Total Associated tsRNA Number:195
More Information
Network:
(Display the first 15 nodes)



Evidence Support

Strong Evidence:RT-PCR
Weak Evidence:High-throughput sequencing



Reference

[1] PubMed ID:33527013
Disease Name:Colorectal Neoplasms
Tissue:Colorectal Cancer
Dysfunction Pattern:Down-Regulation
Validated Method:RT-PCR//High-throughput sequencing
Description:TRF-20-M0NK5Y93 suppresses the metastasis of colon cancer cells by impairing the epithelial-to-mesenchymal transition through targeting Claudin-1.
Comparision:Hypoxia VS Control
Mechanism:tRF-20-M0NK5Y93 inhibited CRC cell migration and invasion partly by targeting Claudin-1, an EMT-related molecule. The results of the present study suggest that tRF-20-M0NK5Y93 promotes CRC cell migration and invasion partly by regulating Claudin-1 during EMT.