Entry Detail


General Information

Database ID:TRD00409
Confidence:High
Contents:>> tsRNA Information
>> tsRNA Association Statistics
>> Disease Information
>> Disease Association Statistics
>> Evidence Support
>> Reference



tsRNA Information

tsRNA Name:tRF-20-M0NK5Y93
tsRNA Type:i-tRF
Amino acid and Anticodon:ArgCCG
Sequence:CGGAGCTGGGGATTGTGGGT
Related Target:MALAT1
Predicted Target:CDCP2//AL357673.1//MUC5B//TMEM150C//MUC12//C1orf159//SLC39A13//MAOA//MROH1//RILP
External Links:
MINTbase ID:tRF-20-M0NK5Y93
tRFdb ID:N/A

[1] gtRNAdb_ID:tRNA-Arg-CCG-2-1
Anticodon:ArgCCG
tRNA_number:trna23
Chromosome:17
Strand:-
Coordinate:Start Site(bp): 66016032        End Site(bp): 66016051



tsRNA Association Statistics

Total Associated Disease Number:12
More Information
Network:
(Display the first 15 nodes)



Disease Information

 MeSHDisease Ontology
Disease ID:D003110 DOID:219
Disease Name:Colonic Neoplasmscolon cancer
Category:MeSHDisease Ontology
Type:Neoplasms//Digestive System Diseasesdisease of anatomical entity//disease of cellular proliferation
Define:Tumors or cancer of the COLON.A colorectal cancer that is located_in the colon.
Alias:Cancer of Colon//Cancer of the Colon//Colon Adenocarcinoma//Colon Cancer//Colon Neoplasms//Colonic Cancer//Neoplasms, ColonicN/A



Disease Association Statistics

Total Associated tsRNA Number:91
More Information
Network:
(Display the first 15 nodes)



Evidence Support

Strong Evidence:Transfection//RT-PCR
Weak Evidence:High-throughput sequencing



Reference

[1] PubMed ID:37034215
Disease Name:Colonic Neoplasms
Tissue:Colon
Dysfunction Pattern:Down-Regulation
Validated Method:Transfection//RT-PCR//High-throughput sequencing
Description:In a previous study, we observed that the expression of 14 tRFs differed significantly in colon cancer cells under hypoxic conditions [14]. Among them, tRF-20-M0NK5Y93 showed the most significant difference, showing decreased expression compared with normoxia.
Comparision:Hypoxic VS Normoxia
Mechanism:Mechanistic investigations indicated that tRFs could regulate the expression of MALAT-1 by binding to specific sites on MALAT-1. MALAT1, which is a long noncoding RNA (lncRNA), regulates alternative splicing of (structural maintenance of chromosomes 1A) SMC1A by interaction with SRSF2, resulting in discrepant expression of various isoforms, SMC1A001, SMC1A201, SMC1A005, and SMC1A003.