Entry Detail



General Information

Database ID:TRD00387
Confidence:High
Contents:>> tsRNA Information
>> tsRNA Association Statistics
>> Disease Information
>> Disease Association Statistics
>> Evidence Support
>> Reference



tsRNA Information

tsRNA Name:AS-tDR-001363
tsRNA Type:5'-tiRNA
Amino acid and Anticodon:N/A
Sequence:GCCCCGGCTAGCTCAGTCGGTAGAGCATGGGACTCT
Related Target:N/A
Predicted Target:EBI3//COMMD2//NHLRC1//FLYWCH1//NAAA//MKNK1//RPS6KA2//ATXN2//SPIRE2//USP24
External Links:
MINTbase ID:N/A
tRFdb ID:N/A



tsRNA Association Statistics

Total Associated Disease Number:12
More Information
Network:
(Display the first 15 nodes)



Disease Information

 MeSHDisease Ontology
Disease ID:D012214DOID:0050827
Disease Name:Rheumatic Heart Diseaserheumatic heart disease
Category:MeSHDisease Ontology
Type:Infections//Cardiovascular Diseasesdisease of anatomical entity
Define:Cardiac manifestation of systemic rheumatological conditions, such as RHEUMATIC FEVER. Rheumatic heart disease can involve any part the heart, most often the HEART VALVES and the ENDOCARDIUM.A heart valve disease that is characterized by repeated inflammation with fibrinous repair caused by an autoimmune reaction to Group A beta-hemolytic streptococci (GAS) that results in valvular damage. The cardinal anatomic changes of the valve include leaflet thickening, commissural fusion, and shortening and thickening of the tendinous cords.
Alias:Bouillaud Disease//Bouillaud's Diseaserheumatic carditis



Disease Association Statistics

Total Associated tsRNA Number:66
More Information
Network:
(Display the first 15 nodes)



Evidence Support

Strong Evidence:RT-PCR
Weak Evidence:High-throughput sequencing



Reference

[1] PubMed ID:34926598
Disease Name:Rheumatic Heart Disease
Tissue:Heart
Dysfunction Pattern:Up-Regulation
Validated Method:RT-PCR//High-throughput sequencing
Description:Fourteen tsRNAs (4 up-regulated: AS-tDR-001270, AS-tDR-001297, AS-tDR-001269, and AS-tDR-001289; 10 down-regulated: AS-tDR-000205, AS-tDR-000123, AS-tDR-007294, AS-tDR-007326, AS-tDR-007245, AS-tDR-000102, AS-tDR-006049, AS-tDR-001363, AS-tDR-000886, AS-tDR-000894) were significantly altered in RHD with the AF group compared with RHD without AF group (Figure 3B, Table 1).
Comparision:AF RHD VS NAF RHD
Mechanism:Data Mining uncovered the altered biological functions, including regulation of transcription, DNA binding, intracellular, and cytokine-cytokine receptor interaction. These results aimed to explore the regulatory role of tsRNAs in RHD with AF.