Entry Detail



General Information

Database ID:TRD00309
Confidence:Median
Contents:>> tsRNA Information
>> tsRNA Association Statistics
>> Disease Information
>> Disease Association Statistics
>> Evidence Support
>> Reference



tsRNA Information

tsRNA Name:tiRNA-Ser-GCT-001
tsRNA Type:5'-tiRNA
Amino acid and Anticodon:SerGCT
Sequence:AAGAAAGATTGCAAGAACTG
Related Target:N/A
Predicted Target:AP1G1//MESP1//TBK1//YME1L1//OR11H4//PHTF2//CNBD1//PSMD9//GPR180//TAPT1
External Links:
MINTbase ID:N/A
tRFdb ID:N/A



tsRNA Association Statistics

Total Associated Disease Number:31
More Information
Network:
(Display the first 15 nodes)



Disease Information

 MeSHDisease Ontology
Disease ID:D009914DOID:5773
Disease Name:Oral Submucous Fibrosisoral submucous fibrosis
Category:MeSHDisease Ontology
Type:Stomatognathic Diseasesdisease of anatomical entity
Define:Irreversible FIBROSIS of the submucosal tissue of the MOUTH.A mouth disease that is characterized by juxta-epithelial inflammatory reaction and progressive fibrosis of the submucosal tissues.
Alias:N/AOral cavity Submucous Fibrosis//Oral submucosal fibrosis//Oral submucosal fibrosis, including of tongue



Disease Association Statistics

Total Associated tsRNA Number:126
More Information
Network:
(Display the first 15 nodes)



Evidence Support

Strong Evidence:N/A
Weak Evidence:High-throughput sequencing



Reference

[1] PubMed ID:34558114
Disease Name:Oral Submucous Fibrosis
Tissue:Oral Submucous Fibrosis
Dysfunction Pattern:Up-Regulation
Validated Method:High-throughput sequencing
Description:Of 126 tsRNAs in OSF were dysregulated, including 73 upregulated tsRNAs and 53 downregulated tsRNAs. The downregulated tiRNA-Val-CAC-002,tRF-Asn-GTT-005, tRF-Trp-CCA-007 and upregulated tRF-Gly-TCC-016,tRF-Pro-TGG-009 showed significant differences by qRT-PCR validation.
Comparision:Disease VS Control
Mechanism:tRNA-derived fragments are dysregulated and could be involved in the pathogenesis of oral submucous fibrosis.