Entry Detail


General Information

Database ID:TRD00177
Confidence:High
Contents:>> tsRNA Information
>> tsRNA Association Statistics
>> Disease Information
>> Disease Association Statistics
>> Evidence Support
>> Reference



tsRNA Information

tsRNA Name:tiRNA-Gly-GCC-001
tsRNA Type:5'-tiRNA
Amino acid and Anticodon:GlyGCC
Sequence:GCATAGGTGGTTCAGTGGTAGAATTCTTGCCTG
Related Target:BDNF
Predicted Target:FCGR2A//LHX8//ZNF513//NDUFAF1//ZNF778//KCTD9//ERAS//SPRN//SORCS1//ARPP21
External Links:
MINTbase ID:N/A
tRFdb ID:N/A



tsRNA Association Statistics

Total Associated Disease Number:12
More Information
Network:
(Display the first 15 nodes)



Disease Information

 MeSHDisease Ontology
Disease ID:D013119N/A
Disease Name:Spinal Cord InjuriesN/A
Category:MeSHDisease Ontology
Type:Nervous System Diseases//Wounds and InjuriesN/A
Define:Penetrating and non-penetrating injuries to the spinal cord resulting from traumatic external forces (e.g., WOUNDS, GUNSHOT; WHIPLASH INJURIES; etc.).N/A
Alias:Injuries, Spinal Cord//Myelopathy, Traumatic//Post-Traumatic Myelopathy//Spinal Cord Contusion//Spinal Cord Laceration//Spinal Cord Transection//Spinal Cord TraumaN/A



Disease Association Statistics

Total Associated tsRNA Number:68
More Information
Network:
(Display the first 15 nodes)



Evidence Support

Strong Evidence:RT-PCR
Weak Evidence:High-throughput sequencing



Reference

[1] PubMed ID:31998075
Disease Name:Spinal Cord Injuries
Tissue:N/A
Dysfunction Pattern:Up-Regulation
Validated Method:RT-PCR//High-throughput sequencing
Description:We validated the candidate tsRNAs and found opposite trends in the expression levels of the tsRNAs and BDNF after SCI.
Comparision:Treatment VS Control
Mechanism:predicted tiRNA-Gly-GCC-001 might be involved in the MAPK and neurotrophin pathways by targeting the BDNF, thus regulating the post-SCI pathophysiologic processes.