Entry Detail


General Information

Database ID:TRD00161
Confidence:Very High
Contents:>> tsRNA Information
>> tsRNA Association Statistics
>> Disease Information
>> Disease Association Statistics
>> Evidence Support
>> Reference



tsRNA Information

tsRNA Name:5’tiRNAGly-GCC
tsRNA Type:5'-tiRNA
Amino acid and Anticodon:GlyGCC
Sequence:GCAGGCGAATTCTACCACTGAACCAATGC
Related Target:N/A
Predicted Target:SNX22//EIF5A//CRB1//NR2E3//TYRO3//EXTL3//RASAL2//TTC16//PINK1//CNTNAP1
External Links:
MINTbase ID:N/A
tRFdb ID:N/A



tsRNA Association Statistics

Total Associated Disease Number:1
More Information
Network:
(Display the first 15 nodes)



Disease Information

 MeSHDisease Ontology
Disease ID:D000690DOID:332
Disease Name:Amyotrophic Lateral Sclerosisamyotrophic lateral sclerosis
Category:MeSHDisease Ontology
Type:Nervous System Diseases//Nutritional and Metabolic Diseasesdisease of anatomical entity
Define:A degenerative disorder affecting upper MOTOR NEURONS in the brain and lower motor neurons in the brain stem and SPINAL CORD. Disease onset is usually after the age of 50 and the process is usually fatal within 3 to 6 years. Clinical manifestations include progressive weakness, atrophy, FASCICULATION, hyperreflexia, DYSARTHRIA, dysphagia, and eventual paralysis of respiratory function. Pathologic features include the replacement of motor neurons with fibrous ASTROCYTES and atrophy of anterior SPINAL NERVE ROOTS and corticospinal tracts. (From Adams et al., Principles of Neurology, 6th ed, pp1089-94)A motor neuron disease that is characterized by muscle spasticity, rapidly progressive weakness due to muscle atrophy, difficulty in speaking, swallowing, and breathing.
Alias:ALS - Amyotrophic Lateral Sclerosis//Amyotrophic Lateral Sclerosis With Dementia//Amyotrophic Lateral Sclerosis, Guam Form//Amyotrophic Lateral Sclerosis, Parkinsonism-Dementia Complex of Guam//Amyotrophic Lateral Sclerosis-Parkinsonism-Dementia Complex 1//Charcot Disease//Dementia With Amyotrophic Lateral Sclerosis//Gehrig's Disease//Guam Disease//Guam Form of Amyotrophic Lateral Sclerosis//Lou Gehrig Disease//Lou Gehrig's Disease//Lou-Gehrigs Disease//Motor Neuron Disease, Amyotrophic Lateral SclerosisALS//Lou Gehrig's disease//motor neuron disease, bulbar



Disease Association Statistics

Total Associated tsRNA Number:57
More Information
Network:
(Display the first 15 nodes)



Evidence Support

Strong Evidence:RT-PCR
Weak Evidence:High-throughput sequencing



Reference

[1] PubMed ID:39719207
Disease Name:Amyotrophic Lateral Sclerosis
Tissue:Nervous System Diseases
Dysfunction Pattern:N/A
Validated Method:RT-PCR//High-throughput sequencing
Description:Recent work has demonstrated induction of specific 5’tiRNAs, including 5’tiRNAGly-GCC, in response to arsenite-induced oxidative stress in primary mouse fibroblasts as well as in various cell lines, including HeLa cells, U2OS cells and PC12 neuronal cells (Elkordy et al., 2018; Sanadgol et al., 2022).
Comparision:Disease VS Control
Mechanism:Urthermore, we also demonstrated induction of 5’tiRNAGly-GCC in primary neurons in response to epoxomicin-induced proteasomal stress and glutamate-induced excitotoxicity, two other types of stress implicated in ALS (Taylor et al., 2016). It should be noted that a more robust tiRNA production was observed following oxidative stress compared to proteasomal stress and excitotoxic stress, which further underscores oxidative stress as a key mediator of ANG-induced tRNA cleavage.