Entry Detail


General Information

Database ID:TRD00156
Confidence:High
Contents:>> tsRNA Information
>> tsRNA Association Statistics
>> Disease Information
>> Disease Association Statistics
>> Evidence Support
>> Reference



tsRNA Information

tsRNA Name:tRF-33-Q1Q89P9L842205
tsRNA Type:5'-tiRNA
Amino acid and Anticodon:GlyCCC
Sequence:GCGCCGCTGGTGTAGTGGTATCATGCAAGATTC
Related Target:PIK3CD
Predicted Target:PTPRK//ESPN//TMEM207//PIGA//FKBP1A//SSH1//CLPTM1//CHERP//ZNF467//ERBB2
External Links:
MINTbase ID:tRF-33-Q1Q89P9L842205
tRFdb ID:N/A

[1] gtRNAdb_ID:tRNA-Gly-CCC-2-2
Anticodon:GlyCCC
tRNA_number:trna34
Chromosome:16
Strand:-
Coordinate:Start Site(bp): 686774        End Site(bp): 686806

[2] gtRNAdb_ID:tRNA-Gly-CCC-2-1
Anticodon:GlyCCC
tRNA_number:trna27
Chromosome:2
Strand:-
Coordinate:Start Site(bp): 70476161        End Site(bp): 70476193



tsRNA Association Statistics

Total Associated Disease Number:1
More Information
Network:
(Display the first 15 nodes)



Disease Information

 MeSHDisease Ontology
Disease ID:D000077195DOID:5520
Disease Name:Squamous Cell Carcinoma of Head and Neckhead and neck squamous cell carcinom
Category:MeSHDisease Ontology
Type:Neoplasmsdisease of cellular proliferation
Define:The most common type of head and neck carcinoma that originates from cells on the surface of the NASAL CAVITY; MOUTH; PARANASAL SINUSES, SALIVARY GLANDS, and LARYNX. Mutations in TNFRSF10B, PTEN, and ING1 genes are associated with this cancer.A head and neck carcinoma that has_material_basis_in squamous cells that line the moist, mucosal surfaces inside the head and neck.
Alias:Carcinoma, Squamous Cell of Head and Neck//HNSCC//Head And Neck Squamous Cell Carcinomas//Head and Neck Squamous Cell Carcinoma//Hypopharyngeal Squamous Cell Carcinoma//Laryngeal Squamous Cell Carcinoma//Oral Cavity Squamous Cell Carcinoma//Oral Squamous Cell Carcinoma//Oral Squamous Cell Carcinomas//Oral Tongue Squamous Cell Carcinoma//Oropharyngeal Squamous Cell Carcinoma//Squamous Cell Carcinoma of Larynx//Squamous Cell Carcinoma of the Head and Neck//Squamous Cell Carcinoma of the Larynx//Squamous Cell Carcinoma of the Mouth//Squamous Cell Carcinoma of the Nasal Cavity//Squamous Cell Carcinoma, Head And Neckcarcinoma of the head and neck//squamous cell carcinoma of the head and neck//squamous cell carcinomas of head and neck



Disease Association Statistics

Total Associated tsRNA Number:38
More Information
Network:
(Display the first 15 nodes)



Evidence Support

Strong Evidence:RT-PCR
Weak Evidence:High-throughput sequencing



Reference

[1] PubMed ID:35644410
Disease Name:Squamous Cell Carcinoma of Head and Neck
Tissue:Laryngeal Squamous Cell Carcinoma
Dysfunction Pattern:Down-Regulation
Validated Method:RT-PCR//High-throughput sequencing
Description:A 5'-tiRNA fragment that inhibits proliferation and migration of laryngeal squamous cell carcinoma by targeting PIK3CD.
Comparision:Cancer VS Normal
Mechanism:tRF-33-Q1Q89P9L842205 suppressed cell growth, proliferation, migration, invasion and induced apoptosis in LSCC by directly silencing phosphoinositide 3-kinase catalytic subunit (PIK3CD). tRF-33-Q1Q89P9L842205 is a potential diagnostic biomarker for LSCC and acts as a tumor suppressor by directly targeting PIK3CD.