Entry Detail


General Information

Database ID:TRD00139
Confidence:High
Contents:>> tsRNA Information
>> tsRNA Association Statistics
>> Disease Information
>> Disease Association Statistics
>> Evidence Support
>> Reference



tsRNA Information

tsRNA Name:tRFGluTTC
tsRNA Type:5'-tiRNA
Amino acid and Anticodon:GluTTC
Sequence:TCCCACATGGTCTAGCGGTTAGGATTCCTGGTTTT
Related Target:KLF9; KLF11; KLF12
Predicted Target:SGMS2//MOB3C//PPP1R26//KMT2B//WSCD2//SRGAP2C//ZNF654//NFKBIL1//KIF1B//DDX41
External Links:
MINTbase ID:tRF-35-86J8WPMN1E8Y7Z
tRFdb ID:N/A

[1] gtRNAdb_ID:tRNA-Glu-TTC-2-1
Anticodon:GluTTC
tRNA_number:trna3
Chromosome:13
Strand:-
Coordinate:Start Site(bp): 45492099        End Site(bp): 45492133

[2] gtRNAdb_ID:tRNA-Glu-TTC-2-2
Anticodon:GluTTC
tRNA_number:trna11
Chromosome:15
Strand:-
Coordinate:Start Site(bp): 26327418        End Site(bp): 26327452



tsRNA Association Statistics

Total Associated Disease Number:3
More Information
Network:
(Display the first 15 nodes)



Disease Information

 MeSHDisease Ontology
Disease ID:D009765DOID:9970
Disease Name:Obesityobesity
Category:MeSHDisease Ontology
Type:Nutritional and Metabolic Diseases//Pathological Conditions, Signs and Symptomsdisease of metabolism
Define:A status with BODY WEIGHT that is grossly above the recommended standards, usually due to accumulation of excess FATS in the body. The standards may vary with age, sex, genetic or cultural background. In the BODY MASS INDEX, a BMI greater than 30.0 kg/m2 is considered obese, and a BMI greater than 40.0 kg/m2 is considered morbidly obese (MORBID OBESITY).An overnutrition that is characterized by excess body fat, traditionally defined as an elevated ratio of weight to height (specifically 30 kilograms per meter squared), has_material_basis_in a multifactorial etiology related to excess nutrition intake, decreased caloric utilization, and genetic susceptibility, and possibly medications and certain disorders of metabolism, endocrine function, and mental illness.
Alias:N/AN/A



Disease Association Statistics

Total Associated tsRNA Number:55
More Information
Network:
(Display the first 15 nodes)



Evidence Support

Strong Evidence:RT-PCR
Weak Evidence:High-throughput sequencing



Reference

[1] PubMed ID:31336727
Disease Name:Obesity
Tissue:Adipose Tissues And Blood
Dysfunction Pattern:N/A
Validated Method:RT-PCR//High-throughput sequencing
Description:tRFGluTTC, which promoted preadipocyte proliferation by increasing expressions of cell cycle regulatory factors, had the highest fold change in the 296 differentially expressed tRFs.
Comparision:Normal VS Obese
Mechanism:Overexpression of tRFGluTTC significantly promoted 3T3-L1 preadipocyte proliferation, but significantly suppressed 3T3-L1 differentiation. Thus, these findings imply that tRFs may act as novel epigenetic molecules for governing adipogenesis.