Entry Detail


General Information

Database ID:TRD00094
Confidence:Median
Contents:>> tsRNA Information
>> tsRNA Association Statistics
>> Disease Information
>> Disease Association Statistics
>> Evidence Support
>> Reference



tsRNA Information

tsRNA Name:tRF-34-V29K9UV36562FQ
tsRNA Type:5'-tiRNA
Amino acid and Anticodon:GlnTTG
Sequence:TAGGATGGGGTGTGATAGGTGGCACGGAGAATTT
Related Target:N/A
Predicted Target:NRXN2//VSIG10L//ZNF831//INTS6//ATP6V1FNB//PSMD2//PCNX1//BICRA//SLC22A12//ST8SIA2
External Links:
MINTbase ID:tRF-34-V29K9UV36562FQ
tRFdb ID:N/A

[1] gtRNAdb_ID:-
Anticodon:GlnTTG
tRNA_number:trnaMT
Chromosome:MT
Strand:-
Coordinate:Start Site(bp): 4367        End Site(bp): 4400

[2] gtRNAdb_ID:-
Anticodon:GlnTTG
tRNA_number:trnalookalike2
Chromosome:1
Strand:-
Coordinate:Start Site(bp): 564917        End Site(bp): 564950



tsRNA Association Statistics

Total Associated Disease Number:2
More Information
Network:
(Display the first 15 nodes)



Disease Information

 MeSHDisease Ontology
Disease ID:D006528DOID:684
Disease Name:Carcinoma, Hepatocellularhepatocellular carcinoma
Category:MeSHDisease Ontology
Type:Neoplasms//Digestive System Diseasesdisease of anatomical entity//disease of cellular proliferation
Define:A primary malignant neoplasm of epithelial liver cells. It ranges from a well-differentiated tumor with EPITHELIAL CELLS indistinguishable from normal HEPATOCYTES to a poorly differentiated neoplasm. The cells may be uniform or markedly pleomorphic, or form GIANT CELLS. Several classification schemes have been suggested.A liver carcinoma that has_material_basis_in undifferentiated hepatocytes and located_in the liver.
Alias:Hepatocellular Carcinoma//Hepatoma//Liver Cancer, Adult//Liver Cell Carcinoma//Liver Cell Carcinoma, AdultHepatoma



Disease Association Statistics

Total Associated tsRNA Number:61
More Information
Network:
(Display the first 15 nodes)



Evidence Support

Strong Evidence:PCR//Western blot//Northern blot
Weak Evidence:High-throughput sequencing



Reference

[1] PubMed ID:36973570
Disease Name:Carcinoma, Hepatocellular
Tissue:Liver
Dysfunction Pattern:Down-Regulation
Validated Method:PCR//Western blot//Northern blot//High-throughput sequencing
Description:A novel tsRNA, tRNAGln-TTG derived 5′-tiRNA-Gln, is significantly downregulated, and its expression level is correlated with progression in patients.
Comparision:HCC VS Normal
Mechanism: 5′-tiRNA-Gln exerted its function by binding eukaryotic initiation factor 4A-I (EIF4A1), which unwinds complex RNA secondary structures during translation initiation, causing the partial inhibition of translation. The suppressed downregulated proteins include ARAF, MEK1/2 and STAT3, causing the impaired signaling pathway related to HCC progression. Furthermore, based on the construction of a mutant 5′-tiRNA-Gln, the sequence of forming intramolecular G-quadruplex structure is crucial for 5′-tiRNA-Gln to strongly bind EIF4A1 and repress translation.