Entry Detail


General Information

Database ID:TRD00056
Confidence:Very High
Contents:>> tsRNA Information
>> tsRNA Association Statistics
>> Disease Information
>> Disease Association Statistics
>> Evidence Support
>> Reference



tsRNA Information

tsRNA Name:mature-mt_tRNA-Val-TAC_CCA_end
tsRNA Type:3'-tiRNA
Amino acid and Anticodon:ValTAC
Sequence:ACACCCAGAAGATTTCATGACCAATGAACACTCTGACCA
Related Target:Smad3//Mkl1//Ndufs6//Mrpl27
Predicted Target:ZCCHC18//MTUS1//C6orf223//TNKS//FARP1//MTMR3//VPS37A//ZNF26//EXD1//ANKRD9
External Links:
MINTbase ID:N/A
tRFdb ID:N/A



tsRNA Association Statistics

Total Associated Disease Number:1
More Information
Network:
(Display the first 15 nodes)



Disease Information

 MeSHDisease Ontology
Disease ID:D001281DOID:0060224
Disease Name:Atrial Fibrillationatrial fibrillation
Category:MeSHDisease Ontology
Type:Cardiovascular Diseases//Pathological Conditions, Signs and Symptomsdisease of anatomical entity
Define:Abnormal cardiac rhythm that is characterized by rapid, uncoordinated firing of electrical impulses in the upper chambers of the heart (HEART ATRIA). In such case, blood cannot be effectively pumped into the lower chambers of the heart (HEART VENTRICLES). It is caused by abnormal impulse generation.A heart conduction disease that is characterized by uncoordinated electrical activity in the heart's upper chambers (the atria), which causes the heartbeat to become fast and irregular and has symptoms palpitations, weakness, fatigue, lightheadedness, dizziness, confusion, shortness of breath and chest pain.
Alias:Auricular Fibrillation//Familial Atrial Fibrillation//Paroxysmal Atrial Fibrillation//Persistent Atrial FibrillationA-fib//AFib



Disease Association Statistics

Total Associated tsRNA Number:38
More Information
Network:
(Display the first 15 nodes)



Evidence Support

Strong Evidence:RT-PCR
Weak Evidence:High-throughput sequencing



Reference

[1] PubMed ID:39076782
Disease Name:Atrial Fibrillation
Tissue:Heart
Dysfunction Pattern:N/A
Validated Method:RT-PCR//High-throughput sequencing
Description:According to published literature on rodents (including rats and mice), the dose of curcumin (100 mg/kg/d) used in this study is effective and safe (Moulin et al., 2020; Topcu-Tarladacalisir et al., 2013). And in our previous research, we also found that curcumin (100 mg/kg/d, oral) improved atrial fibrosis, and decreased the susceptibility of AF in aged mice when compared to 50 mg/kg/day of curcumin and control group (Gao et al., 2023). So in this study, we used curcumin (100 mg/kg/day, oral) to predict its mechanism in the treatment of aging-related AF by regulating tsRNAs, and verified those results with in vitro and in-vivo experiments.
Comparision:Disease VS Control
Mechanism:TsRNA is a new type of small non-coding RNA of epigenetic regulatory factors, and is involved in physiological and pathological processes such as gene expression, cell apoptosis, and epigenetics. A very important function of tsRNA is to regulate gene expression by binding to mRNA in a sequence-specific manner similar to miRNA (Zhang et al., 2020).