Entry Detail



General Information

Database ID:TRD00014
Confidence:High
Contents:>> tsRNA Information
>> tsRNA Association Statistics
>> Disease Information
>> Disease Association Statistics
>> Evidence Support
>> Reference



tsRNA Information

tsRNA Name:tRF-28-OB1690PQR304
tsRNA Type:tRF-5
Amino acid and Anticodon:SerTGA
Sequence:GAAAAAGTCATGGAGGCCATGGGGTTGG
Related Target:N/A
Predicted Target:STRN4//PGLYRP2//NCOR2//SSTR1//OMP//CCHCR1//ERGIC1//ANKRD54//AGBL5//ZNF592
External Links:
MINTbase ID:tRF-28-OB1690PQR304
tRFdb ID:N/A

[1] gtRNAdb_ID:-
Anticodon:SerTGA
tRNA_number:trnaMT
Chromosome:MT
Strand:-
Coordinate:Start Site(bp): 7487        End Site(bp): 7514

[2] gtRNAdb_ID:-
Anticodon:SerTGA
tRNA_number:trnalookalike6
Chromosome:1
Strand:-
Coordinate:Start Site(bp): 568038        End Site(bp): 568065



tsRNA Association Statistics

Total Associated Disease Number:15
More Information
Network:
(Display the first 15 nodes)



Disease Information

 MeSHDisease Ontology
Disease ID:D020181DOID:0050848
Disease Name:Sleep Apnea, Obstructiveobstructive sleep apnea
Category:MeSHDisease Ontology
Type:Respiratory Tract Diseases//Nervous System Diseasesdisease of mental health
Define:A disorder characterized by recurrent apneas during sleep despite persistent respiratory efforts. It is due to upper airway obstruction. The respiratory pauses may induce HYPERCAPNIA or HYPOXIA. Cardiac arrhythmias and elevation of systemic and pulmonary arterial pressures may occur. Frequent partial arousals occur throughout sleep, resulting in relative SLEEP DEPRIVATION and daytime tiredness. Associated conditions include OBESITY; ACROMEGALY; MYXEDEMA; micrognathia; MYOTONIC DYSTROPHY; adenotonsilar dystrophy; and NEUROMUSCULAR DISEASES. (From Adams et al., Principles of Neurology, 6th ed, p395)A sleep apnea that is characterized by repeated collapse and obstruction of the upper airway during sleep, which results in reduced airflow (hypopnea) or complete airflow cessation (apnea), oxygen desaturation, and arousals from sleep.
Alias:Apnea, Obstructive Sleep//OSAHS//Obstructive Sleep Apnea//Obstructive Sleep Apnea Syndrome//Sleep Apnea Hypopnea Syndrome//Sleep Apnea Syndrome, Obstructive//Syndrome, Obstructive Sleep Apnea//Syndrome, Sleep Apnea, Obstructive//Syndrome, Upper Airway Resistance, Sleep Apnea//Upper Airway Resistance Sleep Apnea Syndromeobstructive sleep apnea syndrome



Disease Association Statistics

Total Associated tsRNA Number:67
More Information
Network:
(Display the first 15 nodes)



Evidence Support

Strong Evidence:RT-PCR
Weak Evidence:High-throughput sequencing



Reference

[1] PubMed ID:37325347
Disease Name:Sleep Apnea, Obstructive
Tissue:Peripheral Venous Blood
Dysfunction Pattern:Down-Regulation
Validated Method:RT-PCR//High-throughput sequencing
Description:N/A
Comparision:Disease VS Control
Mechanism:The plasma levels of tRF-16-79MP9PD and tRF-28-OB1690PQR304 were downregulated in 4- to 7-year-old children with OSAHS and were closely related to the clinical parameters of OSAHS children.