Entry Detail


General Information

Database ID:TRD00002
Confidence:Median
Contents:>> tsRNA Information
>> tsRNA Association Statistics
>> Disease Information
>> Disease Association Statistics
>> Evidence Support
>> Reference



tsRNA Information

tsRNA Name:tRF-20-S998LO9D
tsRNA Type:tRF-5
Amino acid and Anticodon:ArgTCT
Sequence:GTCTCTGTGGCGCAATGGAC
Related Target:N/A
Predicted Target:GABRB3//ACVR2B//ALDH7A1//HES7//FBH1//PXYLP1//EFCAB5//SEPTIN1//VSIG10L2//TBC1D5
External Links:
MINTbase ID:tRF-20-S998LO9D
tRFdb ID:tRNA-Arg-TCT-4-1

[1] gtRNAdb_ID:tRNA-Arg-TCT-4-1
Anticodon:ArgTCT
tRNA_number:trna86
Chromosome:1
Strand:-
Coordinate:Start Site(bp): 159111455        End Site(bp): 159111474



tsRNA Association Statistics

Total Associated Disease Number:41
More Information
Network:
(Display the first 15 nodes)



Disease Information

 MeSHDisease Ontology
Disease ID:D000077195DOID:5520
Disease Name:Squamous Cell Carcinoma of Head and Neckhead and neck squamous cell carcinom
Category:MeSHDisease Ontology
Type:Neoplasmsdisease of cellular proliferation
Define:The most common type of head and neck carcinoma that originates from cells on the surface of the NASAL CAVITY; MOUTH; PARANASAL SINUSES, SALIVARY GLANDS, and LARYNX. Mutations in TNFRSF10B, PTEN, and ING1 genes are associated with this cancer.A head and neck carcinoma that has_material_basis_in squamous cells that line the moist, mucosal surfaces inside the head and neck.
Alias:Carcinoma, Squamous Cell of Head and Neck//HNSCC//Head And Neck Squamous Cell Carcinomas//Head and Neck Squamous Cell Carcinoma//Hypopharyngeal Squamous Cell Carcinoma//Laryngeal Squamous Cell Carcinoma//Oral Cavity Squamous Cell Carcinoma//Oral Squamous Cell Carcinoma//Oral Squamous Cell Carcinomas//Oral Tongue Squamous Cell Carcinoma//Oropharyngeal Squamous Cell Carcinoma//Squamous Cell Carcinoma of Larynx//Squamous Cell Carcinoma of the Head and Neck//Squamous Cell Carcinoma of the Larynx//Squamous Cell Carcinoma of the Mouth//Squamous Cell Carcinoma of the Nasal Cavity//Squamous Cell Carcinoma, Head And Neckcarcinoma of the head and neck//squamous cell carcinoma of the head and neck//squamous cell carcinomas of head and neck



Disease Association Statistics

Total Associated tsRNA Number:38
More Information
Network:
(Display the first 15 nodes)



Evidence Support

Strong Evidence:N/A
Weak Evidence:High-throughput sequencing//Data Mining



Reference

[1] PubMed ID:33202812
Disease Name:Squamous Cell Carcinoma of Head and Neck
Tissue:N/A
Dysfunction Pattern:Up-Regulation
Validated Method:High-throughput sequencing//Data Mining
Description:The top prognostic marker,tRF-20-S998LO9D (p<00.001),was further measured in tumor and tumor-free samples from 16 patients with squamous cell carcinoma of the oral tongue and 12 healthy controls,and was significantly upregulated in tumor compared to matched tumor-free tongue (p<00.001).
Comparision:N/A
Mechanism:N/A